Printer Friendly
Dictionary, Encyclopedia and Thesaurus - The Free Dictionary
3,896,570,551 visitors served.
forum Join the Word of the Day Mailing List For webmasters
?
Dictionary/
thesaurus
Medical
dictionary
Legal
dictionary
Financial
dictionary
Acronyms
 
Idioms
Encyclopedia
Wikipedia
encyclopedia
?

ribosomal RNA
(redirected from 16S rDNA)

    Also found in: Medical, Wikipedia 0.01 sec.
ribosomal RNA
n. Abbr. rRNA
The RNA that is a permanent structural part of a ribosome.
ribosomal RNA
n
(Life Sciences & Allied Applications / Biochemistry) Biochem a type of RNA thought to be transcribed from DNA in the nucleoli of cell nuclei, subsequently forming the component of ribosomes on which the translation of messenger RNA into protein chains is accomplished Sometimes shortened to rRNA
ribosomal RNA  (rb-sml)
The RNA that is a structural component of a ribosome. Comparison of gene sequences of the ribosomal RNA of different organisms has been used to determine evolutionary relationships among the organisms. See more at RNA.
Want to thank TFD for its existence? Tell a friend about us, add a link to this page, add the site to iGoogle, or visit the webmaster's page for free fun content.
?Page tools
Printer friendly
Cite / link 		Feedback
Add definition
Mentioned in?  References in periodicals archive?   Dictionary browser?   Full browser?
 
Haake, (2005) Rapid, species-specific detection of uropathogen 16S rDNA and rRNA at ambient temperature by dot-blot hybridization and an electrochemical sensor array, Mol.
A MCMC strategy for group-specific 16S rRNA probe design by Wu, Yi-Bo; Yan, Li-Rong; Liu, Hui; Sun, Han-Chang; Xie, Hong-Wei / Journal of Biomedical Science and Engineering (JBiSE)
Two genotypes, based on 16S rDNA differences, have been described (1).
Molecular epidemiology of feline and human Bartonella henselae ... by Bouchouicha, Rim; Durand, Benoit; Monteil, Martine; Chomel, B.B.; Berrich, Moez; Arvand, Mardjan; Bi / Emerging Infectious Diseases
16S rDNA from the extracted DNA samples was PCR--amplified using the universal eubacterial primers 8Fhex (5'AGAGTTTGATCCTGGCTCAG) and 1392R (3'ACGGGCGGTGTGTRC) (Invitrogen Life Technologies, Carlsbad, California).
Soil bacterial community structure under exotic versus native ... by Swedo, Barbara L.; Glinka, Clare; Rollo, David R.; Reynolds, Heather L. / Proceedings of the Indiana Academy of Science
 
 
 
Dictionary, Thesaurus, and Translations
?

Terms of Use | Privacy policy | Feedback | Advertise with Us | Copyright © 2012 Farlex, Inc.
Disclaimer
All content on this website, including dictionary, thesaurus, literature, geography, and other reference data is for informational purposes only. This information should not be considered complete, up to date, and is not intended to be used in place of a visit, consultation, or advice of a legal, medical, or any other professional.