antiporter


Also found in: Medical, Encyclopedia, Wikipedia.

antiporter

(ˈæntɪˌpɔːtə)
n
(Biology) biology a membrane protein that transports substances across cell membranes
References in periodicals archive ?
AX09 displays robust and specific antibody response against cystine-glutamate antiporter system protein xCT (SLC7A11), which has been found to be overexpressed in cancer stem cells.
The molecular nature of Na+ sensors is still unclear, the plasma membrane Na+/H+ antiporter SOS1 (Salt Overly Sensitive1) is a possible candidate because its cytoplasmic end is assumed to be involved in Na+ sensing (Zhu, 2003).
antiporter SOS 1 is mediated by MPK6 under salt stress (Yu et al.
An ORF (RWLH02992) similar to the chloramphenicol export proton antiporter (multidrug efflux system protein MtdL) was identified, as in other pathogenic E.
antiporter activity and an increase in intracellular pH have been reported after exposure to estrogen and estradiol (Ediger et al.
1996) Efflux pump of the proton antiporter family confers low-level fluoroquinolone resistance in Mycobacterium smegmatis.
Letm1, the mitochondrial Ca [sup]2+ /H [sup]+ antiporter, is essential for normal glucose metabolism and alters brain function in Wolf-Hirschhorn syndrome.
The insertion was found at the same location in NTUH-K2044 and SB4935 genomes; that is, immediately downstream of a tRNA-Asn locus adjacent to gene KP1_3578 coding for a sodium:proton antiporter.
R:AGTTCAAGTCTGCCCCATTG bulgaricus Lactobacillus F: CCAGATCAGCCAACTTCACA Arginine- fermentum R: GGCAAACTTCAAGAGGACCA Ornitine antiporter Salmonella spp.
The glucose-6-phosphate transporter is a phosphate-linked antiporter deficient in glycogen storage disease type Ib and Ic.