chemokine

(redirected from CCL1)
Also found in: Thesaurus, Medical, Encyclopedia, Wikipedia.

che·mo·kine

 (kē′mō-kīn′, kĕm′ō-)
n.
Any of various chemotactic cytokines that are released by several cell types and act to attract monocytes, neutrophils, and other white blood cells to sites of injury or inflammation.

chemokine

(ˈkiːməʊˌkaɪn)
n
a type of protein produced during inflammation that activates white blood cells
References in periodicals archive ?
The current nomenclature is thus based on these families, eg, CCL1 for ligand 1 of the CC family of chemokines and CCR1 for its respective receptor.
In the part of up and different stages of immune responses in both chicken down regulated genes differentially expressed, TLR5, groups, while CCL1, IL8, CD79B and CCL5 were THBS1, KIT, and FGF10 were identified to be up-regulated identified to be down-regulated, and are shown in Table 2 and 3.
Primer pairs used to analyze gene expression by quantitative RT-PCR, and size of product Gene Forward primer (a) Reverse primer (a) THBS1 TTCAAGCGGAGTAACTGGCGTAG TGTGCAGTGGCACAAATAGCAA KIT CCCTTGCAGAGACCCACATTC TCTGTAGCATTGCCTTGAGTGGA FGF10 CTGTAGAAATTGGAGTTGTGGCAGT GCCTTCCATTGTGCTTCCAAT CCL1 AAACTGCTCCCGCAGAGCTATTA TTGGTGGCAGCTCACGTTG GAPDF GAGAAATTGTGCGTGACATCA CCTGAACCTCTCATTGCCA Gene Size (bp) THBS1 95 KIT 122 FGF10 180 CCL1 135 GAPDF 152 (a) Sequences of oligonucleotides are indicated from 5' to 3' end.