CD4


Also found in: Thesaurus, Medical, Acronyms, Encyclopedia, Wikipedia.

CD4

 (sē′dē-fôr′)
n.
A glycoprotein that is found on the surface of T cells, especially helper T cells, and functions as a receptor in activation of the cells. In humans, HIV gains entry to helper T cells by binding to the CD4 receptor.

[c(luster of) d(ifferentiation antigen) 4.]

CD4


n.
a protein on the surface of T cells and other cells, functioning as a receptor for the AIDS virus antigen.
[1980–85; c(luster of) d(ifferentiation) 4]
ThesaurusAntonymsRelated WordsSynonymsLegend:
Noun1.CD4 - a glycoprotein that is found primarily on the surface of helper T cells; "CD4 is a receptor for HIV in humans"
glycoprotein - a conjugated protein having a carbohydrate component
References in periodicals archive ?
A related study presented at the 2011 International AIDS Society conference showed that for Mozambican clinics with a large number of patients, especially those which do not have any laboratory access, the point-of-care CD4 test would be cost-effective.
Nine of 15 studies were carried out with the objective of estimating normal range for CD4 count; in four studies values were obtained from normal healthy subjects as a control group in comparison with others.
Relationship between CD4 count and CD4% in HIV infected people.
They recorded the last CD4 count before people started antiretroviral therapy and the last CD4 count in the first, second, third, fourth, and fifth years of treatment.
Primers for detecting SNPs of the porcine CD4 gene Position Primer sequence (5'-3') Tm Product ([degrees]C) size (bp) Promoter 1 CCAGGTCATGCCATTTTCTT 57.
CD4 T cell help is limiting and selective during the primary B cell response to influenza virus infection.
Impact of point-of-care CD4 testing on linkage to HIV care: A systematic review.
a leader in chip-based bioanalysis technologies, today announced that its readerless CD4 point-of-care (POC) technology was selected by Imperial College London's CD4 Initiative as the best-performing POC test method for measuring CD4 T-cell count in HIV/AIDS patients.
The CD4 T cell count in peripheral blood is an important prognostic marker in the context of HIV infection.
The discovery that rates of nonopportunistic diseases vary according to CD4 counts "starts to build a case that people aren't just .
The collection tubes currently used for CD4 testing limit post-collection transport time from two to three days or less, at storage conditions of only 20-25 degrees C.