chopper

(redirected from Choppa)
Also found in: Thesaurus, Encyclopedia, Wikipedia.

chop·per

 (chŏp′ər)
n.
1. One that chops: a vegetable chopper.
2. Archaeology A crudely flaked core tool, especially one of the early Paleolithic Period.
3. A device that interrupts an electric current or a beam of radiation.
4. Informal A helicopter.
5. choppers Slang Teeth, especially a set of false teeth.
6. Informal A motorcycle, especially one that is customized.
7. Baseball A ground ball that is hit with a chopping swing, especially one that bounces high off the infield.
intr. & tr.v. chop·pered, chop·per·ing, chop·pers
Informal To travel by helicopter or transport (someone or something) by helicopter.

chopper

(ˈtʃɒpə)
n
1. (Tools) chiefly Brit a small hand axe
2. (Tools) a butcher's cleaver
3. a person or thing that cuts or chops
4. (Aeronautics) an informal name for a helicopter
5. chiefly Brit a slang name for penis
6. (Electrical Engineering) a device for periodically interrupting an electric current or beam of radiation to produce a pulsed current or beam. See also vibrator2
7. (Automotive Engineering) a type of bicycle or motorcycle with very high handlebars and an elongated saddle
8. (Automotive Engineering) NZ a child's bicycle
9. (Firearms, Gunnery, Ordnance & Artillery) obsolete slang chiefly US a sub-machine-gun

chop•per

(ˈtʃɒp ər)

n.
1. a person or thing that chops.
2. a short ax with a large blade, used for cutting up meat; butcher's cleaver.
3. choppers, Slang. the teeth.
4. a helicopter.
5. a motorcycle.
v.i.
6. to travel by helicopter or motorcycle.
[1545–55]
ThesaurusAntonymsRelated WordsSynonymsLegend:
Noun1.chopper - a grounder that bounces high in the air
ground ball, groundball, grounder, hopper - (baseball) a hit that travels along the ground
2.chopper - informal terms for a human `tooth'chopper - informal terms for a human `tooth'  
tooth - hard bonelike structures in the jaws of vertebrates; used for biting and chewing or for attack and defense
3.chopper - an aircraft without wings that obtains its lift from the rotation of overhead bladeschopper - an aircraft without wings that obtains its lift from the rotation of overhead blades
vane, blade - flat surface that rotates and pushes against air or water
cargo helicopter - a helicopter that carries cargo
heavier-than-air craft - a non-buoyant aircraft that requires a source of power to hold it aloft and to propel it
landing skid - one of two parts of the landing gear of a helicopter
rotor - rotating mechanism consisting of an assembly of rotating airfoils; "there are horizontal rotors on a helicopter or compressor rotors in a jet engine"
shuttle helicopter - a helicopter that shuttles back and forth
single-rotor helicopter - a helicopter having a single rotor
skyhook - helicopter carrying a reel of steel cable that can be used to lift and transport heavy objects
4.chopper - a butcher's knife having a large square bladechopper - a butcher's knife having a large square blade
knife - edge tool used as a cutting instrument; has a pointed blade with a sharp edge and a handle
Translations
طائِرَه مَرْوَحِيَّهمَفْرَمَه، ساطور
sekáčekvrtulník
hakkemaskinehelikopter
chopperikopteripaloitteluveitsislaba
húsvágóbárd
òyrlasaxari, kjötöxi
vrtuľník

chopper

[ˈtʃɒpəʳ] N
1. (= axe) → hacha f; [of butcher] → tajadera f, cuchilla f
2. (= helicopter) → helicóptero m (Brit) (= bicycle) bicicleta de manillar alto y asiento alargado (US) (= motorbike) motocicleta de manillar alto y asiento alargado

chopper

[ˈtʃɒpər] n (= helicopter) → hélico m chopping block [ˈtʃɒpɪŋblɒk] nbillot mchopping board [ˈtʃɒpɪŋbɔːrd] nplanche f à découper

chopper

n
(= axe)Hackbeil nt
(inf: = helicopter) → Hubschrauber m
(= bicycle)BMX-Rad nt; (inf: = motorcycle) → Maschine f (inf)

chopper

[ˈtʃɒpəʳ] n (of butcher) → mannaia (Aer) (fam) → elicottero

chop1

(tʃop) past tense past participle chopped verb
(sometimes with up) to cut (into small pieces). He chopped up the vegetables.
noun
a slice of mutton, pork etc containing a rib.
ˈchopper noun
1. an instrument for chopping.
2. a helicopter.
ˈchoppy adjective
(of the sea) rough.
ˈchoppiness noun
chop and change
to keep changing (especially one's mind).
chop down
to cause (especially a tree) to fall by cutting it with an axe. He chopped down the fir tree.
References in periodicals archive ?
GET TO DA CHOPPA TO celebrate its 30th anniversary, Predator will be back on the big screen - for one night only.
com/tv/206248_arnold_schwarzenegger_new_celebrity_apprentice_catchphrase_revealed/) new catchphrases like "You are terminated" and "Get to the choppa," viewers will only have to wait a week to find out who will be the next celebrity making an exit from the competition.
urealyticum F:GTATTTGCAATCTTTATATGTTTTCG 55 R:TTTGTTGTTGCGTTTTCT Organism Amplicon Reference size Mycoplasma spp 287 bp Choppa et al.
His slurry, amiable voice is a rap radio constant--that's his sleepy drawl on the hook of Rick Ross's "Stay Schemin'," on last year's Lords of the Underground-checking "Shot Caller," on the lilting, menacing Waka Flocka Flame collaboration "Choppa Choppa Down.
RIP x Maz, Sarah, Neil, Choppa and Lee xx MOORE Pat A long time dear friend who will be missed.
Vojdani A, Choppa PC, Tagle C, Andrin R, Samimi B, Lapp CW.
Mythic Entertainment, as studio of Electronic Arts Inc (Nasdaq:ERTS), an interactive entertainment software company, announced on Tuesday (17 March) that two new careers, the Dwarf Slayer and Orc Choppa, are now playable in EA's MMORPG, Warhammer Online: Age of Reckoning (WAR).
To do that you need to bring in a few out-of-state features, which I've done with Choppa from Making the Band, Chingo Bling, Lil' Wayne, and Too Short.
Rob Choppa, deputy commander for the deploying brigade.
Kelly, The Chocolate Factory (Jive); Nas, God's Son (Columbia); Lil' Romeo, Game Time (New No Limit); BLACKstreet, Level II (DreamWorks); Choppa, Straight From the N.
It's easy to find good-looking fabrics at $15 per yard," said Bob Choppa, vice president of upholstery for Century Furniture.
Caught in the midst of a civil war in Brazil, it's up to these gods-among-men to fight their way out of this hostile environment as they drop bombs, one-liners, and a smattering of politically incorrect and geographically challenged statements faster than you can say "get to da choppa.