Larget

Related to Larget: target, largest, larger

Lar´get


n.1.A short piece of bar iron for rolling into a sheet; a small billet.
References in periodicals archive ?
FIGURE 4 Wal-Mart's logistics cost-to-serve benchmark for general merchandise Fulfillment center flow Inbound Higher 14% SKU count 24% Handling Lower fixed 29% costs from 44% higher volume Outbound Third party 42% sort centers 47% Wal-Mart Amazon Total Higher Lower ($/units) Total Lower Higher units (M) Maximum assortment Ship from store Handling (in-store only) Higher pick 44% rate + back-of- 39% store picking Outbound Lower 56% number 61% of store locations Wal-Mart larget Total Lower Higher ($/units) Total Lower Higher units (M) Focused assortment Note: Figures provided as a percentage of total cost-to-serve.
You can try out the Big Machine at Techniquest The science attraction has recently unveiled its larget ever exhibit - The Big Machine.
the developer of the world's larget crowdsourced parking network, was announced as the winner for the 'Best Mobile Innovation in Automotive Award'.
RONQUIST F, M TESLENKO, P VAN DER MARK, DL AYRES, A DARLING, S HOHNA, B LARGET, L LIU, MA SUCHARD, and JP HUELSENBECK.
Marcel Larget adopte cependant un chat, tandis que Michel Leiris s'attache a plusieurs animaux sauvages collectes par la mission (Bondaz 2011).
With this transaction, Fosun, which will become the larget shareholder in Ironshore, will be able to further expand its insurance operations and enhance its comprehensive financial capabilities, chairman Guo Guangchang noted.
Apprentice of the Year for the larget employer was presented to 23-year-old Ellis Simpson, of Sandvik Hard Materials.
La 8e edition du festival de Benyekhlef de football s'est terminee, le week-end dernier, a Elouizia au stade municipal dans une tres grande ambiance fleuri par la presence de plusieurs personnalites du monde du sport, d'anciens sportifs comme l'ex-entraineur national Settati ou encore Larget directeur de l'Academie Mohammed VI.
Volkswagen chairman and CEO Martin Winterkorn, said, 'China is already the world's larget sales market for automobiles and further substantial growth is expected in the future.
A pair of primers (5'TTGCAGTACAGGGTATCTGG and 5'GCCTGATTTTGGAACCTGGA) was designed to target a highly conserved region in the LargeT antigen gene of human BKV, resulting in a 75-bp amplicon with a melting temperature (Tm) at 80[degrees]C.
This is the antions larget single Artist Gallary Franchise.