Larget


Related to Larget: target, largest, larger

Lar´get


n.1.A short piece of bar iron for rolling into a sheet; a small billet.
References in periodicals archive ?
Tenders are invited for Gun Type Non-Contact Type Infra Red Thermo Meter Of Model Mt-6, Make Metravi,Raytek Or Lutron Only In Oem Packing With The Following Features: 1 Anti Slip Splash Proof Body, 2 Lazer Pointer Indication To Indicate The Larget Under Test, 3 Data Hold Facility, 4 Auto Power Off, 5 Maximum/ Minimum Record Facility, 6 High Low Alarm Setting, 7 Selectable C/F Degree Scale, 8 Trigger Lock Facility For Continues Measurement On Pressing The Trigger, 9 Over Range/Low Battery Indication, 10 Display:3-1/2 Digits 1999 Counts Backlit Lcd, 11 Range:50 To 550 Degree Centigrade/-58 F To 1012F, 12 Resolution:0.
Apprentice of the Year for the larget employer was presented to 23-year-old Ellis Simpson, of Sandvik Hard Materials.
Today, Exabytes also owns the nation's larget online shopping mall, Easy.
Becky Davis, former Regional Vice President for the world's larget global optical comany, Luxottica, launches her new company, MVPwork, a consulting and executive coaching firm addressing the needs of small business owners.
La 8e edition du festival de Benyekhlef de football s'est terminee, le week-end dernier, a Elouizia au stade municipal dans une tres grande ambiance fleuri par la presence de plusieurs personnalites du monde du sport, d'anciens sportifs comme l'ex-entraineur national Settati ou encore Larget directeur de l'Academie Mohammed VI.
Volkswagen chairman and CEO Martin Winterkorn, said, 'China is already the world's larget sales market for automobiles and further substantial growth is expected in the future.
A pair of primers (5'TTGCAGTACAGGGTATCTGG and 5'GCCTGATTTTGGAACCTGGA) was designed to target a highly conserved region in the LargeT antigen gene of human BKV, resulting in a 75-bp amplicon with a melting temperature (Tm) at 80[degrees]C.
This is the antions larget single Artist Gallary Franchise.
7] Bret Larget, Donald Simon, Joseph Kadane, and Deborah Sweet.
Scottish Hydro Electric are part of Scottish and Southern Energy, one of the larget energy companies in the UK and the third largest company in Scotland.
However, as this report went to press the company was still considering a takeover bid by Barloworld, Australia's third larget paint maker.
Services: Alaska's larget supplier of pipe, valves and fittings to the Alaska oilfields.