Mentioned in

References in periodicals archive

Besides, bands of same size may not come from the same part of the chromosome, change in one restriction site can result in more than one band change, and inability to differentiate isolates to the same degree that can be achieved by whole genome sequencing (WGS) are other key restraining factors.

Pulsed Field Gel Electrophoresis (PFGE) Systems Market Scenario Highlighting Major Drivers & Trends

Xmn1 restriction site was present at 158 bp upstream of the Gamma globin gene on chromosome 11 of positive patients (GenBank KY927385).

Xmn1 Polymorphism: A Silver Lining for [beta]-Thalassemia Patients

Wild type AA genotype showed the presence of restriction site for Hinf I restriction enzyme and digested into two fragments of 177 bp and 73 bp.

Short Communication - A study on Catalase Gene Promoter Polymorphism-21 A/T (rs7943316) in Healthy Pakistani population

The restriction site of the Ear I restriction enzyme is the 5' ...

Screening of BCL-2 associated X protein gene polymorphism associated with scrotal hernia in domesticated swine using polymerase chain reaction-restriction fragment length polymorphism

paca, and two were associated with the restriction site for the enzymes BsiEI (CGRYCG) and MspA1I (CMGCKG).

Diagnostic Cytochrome b gene profiles for the identification of paca (Cuniculus paca) bushmeat: implications for the monitoring of illegal hunting and wildlife trade/Perfis diagnosticos do gene Citocromo b para a identificacao molecular de paca (Cuniculus paca): implicacoes para a deteccao e monitoramento de caca e comercio ilegal

1) was produced using oligonucleotide primers p903SalI (5'GTCGACATAAG TAGGAAATTAAAGTCCAGTAAGGTTACTGGCATTTCT [This oligonucleotide primer was appended with a SalI restriction site (underlined) and the introduced late gene polyhedrin core promoter sequence, ATAAG (bold)]), and p738 (5'ACGAGCT GTGAACT CACCAAGAAT CCAACGTT) with cDNA being generated using oligonucleotide primer p738.

Successful transcription but not translation or assembly of Solenopsis invicta virus 3 in a baculovirus-driven expression system

After analysis of PCR products by amplification of aflD gene, only the samples positive for Aspergillus fungi were used in the restriction site analysis.

Identification of toxigenic Aspergillus species from diet dairy goat using a polyphasic approach/Identificacao de especies toxigenicas de Aspergillus isoladas da dieta de cabras leiteiras utilizando uma abordagem polifasica

Therefore, longer fragments affected by ADO could be misinterpreted as alleles without a mutation in the restriction site. This problem can be avoided with ddRAD, for which two restriction enzymes are utilized (Davey et al., 2013).

Detection and removal of PCR duplicates in population genomic ddRAD studies by addition of a Degenerate Base Region (DBR) in sequencing adapters

The variant T allele has a AvrII restriction site that results in two bands (208 bp and 172 bp) whereas the wild-type C allele lacks the AvrII restriction site, thus producing a single 380-bp band.

The study of DNA methyltransferase-3B promoter variant genotype among Iranian sporadic breast cancer patients

Oligonucleotides used to amplify CLCuKoV promoter were P1 (5' GTTGACTAAAATTGAATCACC-3') as forward with the addition of SacI restriction site and P2 (5'- CAAACGCATACTTAGCAACG-3') as reverse primer with the addition of SalI restriction site.

Characterization of a Strong Constitutive Promoter from Cotton Leaf Curl Kokhran Virus for High Level Gene Expression in Monocotyledonous and Dicotyledonous Plants

The Kpnl_lexA.box_TEM forward primer was designed in order to contain the restriction site KpnI, the lexA regulon and the first twenty-two nucleotides of [bla.sub.tem-1] gene.

Curcumin inhibits the SOS response induced by levofloxacin in Escherichia coli