eubacteria


Also found in: Thesaurus, Medical, Encyclopedia, Wikipedia.
Related to eubacteria: archaebacteria

eu·bac·te·ri·um

 (yo͞o′băk-tîr′ē-əm)
n. pl. eu·bac·te·ri·a (-tîr′ē-ə)

[New Latin eubactērium, back-formed sing. of Eubactēria, former name of the domain Bacteria : Latin eu-, true (the domain Bacteria being considered as comprising the true bacteria, as opposed to the archaea); see eu- + bactēria, pl. of bactērium, bactērium; see bacterium.]

eubacteria

(ˌjuːbækˈtɪərɪə)
pl n, sing -rium (-rɪəm)
(Microbiology) a large group of bacteria characterized by a rigid cell wall and, in motile types, flagella; the true bacteria
[C20: via New Latin from Greek, from eu- (in the sense: true) + bacterium]
ThesaurusAntonymsRelated WordsSynonymsLegend:
Noun1.eubacteria - a large group of bacteria having rigid cell walls; motile types have flagella
moneran, moneron - organisms that typically reproduce by asexual budding or fission and whose nutritional mode is absorption or photosynthesis or chemosynthesis
bacteria, bacterium - (microbiology) single-celled or noncellular spherical or spiral or rod-shaped organisms lacking chlorophyll that reproduce by fission; important as pathogens and for biochemical properties; taxonomy is difficult; often considered to be plants
B, bacillus - aerobic rod-shaped spore-producing bacterium; often occurring in chainlike formations; found primarily in soil
cocci, coccus - any spherical or nearly spherical bacteria
coccobacillus - a bacterial cell intermediate in morphology between a coccus and a bacillus; a very short bacillus
spirilla, spirillum - any flagellated aerobic bacteria having a spirally twisted rodlike form
division Eubacteria - one-celled monerans having simple cells with rigid walls and (in motile types) flagella
clostridia, clostridium - spindle-shaped bacterial cell especially one swollen at the center by an endospore
botulinum, botulinus, Clostridium botulinum - anaerobic bacterium producing botulin the toxin that causes botulism
clostridium perfringens - anaerobic Gram-positive rod bacterium that produces epsilon toxin; can be used as a bioweapon
blue-green algae, cyanobacteria - predominantly photosynthetic prokaryotic organisms containing a blue pigment in addition to chlorophyll; occur singly or in colonies in diverse habitats; important as phytoplankton
phototrophic bacteria, phototropic bacteria - green and purple bacteria; energy for growth is derived from sunlight; carbon is derived from carbon dioxide or organic carbon
pseudomonad - bacteria usually producing greenish fluorescent water-soluble pigment; some pathogenic for plants and animals
xanthomonad - bacteria producing yellow non-water-soluble pigments; some pathogenic for plants
nitric bacteria, nitrobacteria - soil bacteria that convert nitrites to nitrates
nitrosobacteria, nitrous bacteria - soil bacteria that oxidize ammonia to nitrites
thiobacillus - small rod-shaped bacteria living in sewage or soil and oxidizing sulfur
spirillum - spirally twisted elongate rodlike bacteria usually living in stagnant water
vibrio, vibrion - curved rodlike motile bacterium
corynebacterium - any species of the genus Corynebacterium
listeria - any species of the genus Listeria
enteric bacteria, enterics, enterobacteria, entric - rod-shaped Gram-negative bacteria; most occur normally or pathogenically in intestines of humans and other animals
endospore-forming bacteria - a group of true bacteria
rickettsia - any of a group of very small rod-shaped bacteria that live in biting arthropods (as ticks and mites) and cause disease in vertebrate hosts; they cause typhus and other febrile diseases in human beings
chlamydia - coccoid rickettsia infesting birds and mammals; cause infections of eyes and lungs and genitourinary tract
mycoplasma - any of a group of small parasitic bacteria that lack cell walls and can survive without oxygen; can cause pneumonia and urinary tract infection
actinomycete - any bacteria (some of which are pathogenic for humans and animals) belonging to the order Actinomycetales
actinomyces - soil-inhabiting saprophytes and disease-producing plant and animal parasites
mycobacteria, mycobacterium - rod-shaped bacteria some saprophytic or causing diseases
gliding bacteria, myxobacter, myxobacteria, myxobacterium, slime bacteria - bacteria that form colonies in self-produced slime; inhabit moist soils or decaying plant matter or animal waste
lactobacillus - a Gram-positive rod-shaped bacterium that produces lactic acid (especially in milk)
strep, streptococci, streptococcus - spherical Gram-positive bacteria occurring in pairs or chains; cause e.g. scarlet fever and tonsillitis
spirochaete, spirochete - parasitic or free-living bacteria; many pathogenic to humans and other animals
flagellum - a lash-like appendage used for locomotion (e.g., in sperm cells and some bacteria and protozoa)
Translations
eubactérie
References in periodicals archive ?
Hilpert et al [30] found that archaea were insensitive to many antibiotics that act against eubacteria and eukaryotes, such as those inhibiting the synthesis or cross-linkage of the peptide subunit of murein or those that inhibit the synthesis of RNA.
It is thought that eubacteria divided using division machineries that were composed of more than 10 proteins, including filamentous temperature-sensitive (fts) proteins FtsA, FtsB, FtsI, FtsK, FtsL, FtsN, FtsQ, FtsZ, ZipA, and ZapA (Fig.
2015a; 2015b) simultaneously used primers for sequences of 16S rRNA for eubacteria, tuf gene for Staphylococcus genus and three genes for Staphylococcus aureus, spa, mecA and vanA, in the same PCR assay in two different studies.
sup][4] According to their functions in the human body, they are classified into three types: (1) symbiotic bacteria or probiotics, which are intestinal-dominant bacteria mainly composed of strict anaerobic bacteria such as lactic acid bacteria, bifidobacteria, bacteroides, eubacteria, and nitrobacteria.
Skin biopsy samples were also tested by universal eubacteria 16S rRNA gene amplification and sequencing (7).
number Gene probes Eubacteria 16S Euba-F TGGAGCATGTGGTTTAATTCGA X58308 rDNA Euba-R TGCGGGACTTAACCCAACA Euba-S TexTed-CACGAGCTGACGACARCCATGCA-BHQ2 Actinomyces 16S Act-F GGT CTC TGG GCC GTT ACT GA spp.
Regardless of the exact phylogeny of early life form, diversity has arisen out of evolutionary pressure and gives rise to the archaea and eubacteria.
Kogut M (1991) The 'true' intracellular environment of moderately halophilic eubacteria.