osteocalcin


Also found in: Medical, Encyclopedia, Wikipedia.

os·te·o·cal·cin

 (ŏs′tē-ō-kăl′sĭn)
n.
A calcium-binding substance produced by osteoblasts that is essential to bone mineralization and can be used as a biomarker for osteoporosis. It may also act as a hormone to increase insulin production and insulin sensitivity.
Translations

os·te·o·cal·cin

n. osteocalcina, proteína del hueso.
References in periodicals archive ?
The antibody test found osteocalcin in the bones of hadrosaurs, a ceratopsian, and a sauropod dinosaur.
We hypothesise that defective N-glycosylation impairs bone formation by osteoblasts, leading to the observed osteoporosis, and, likely, reduced bone-derived osteocalcin levels, which will in turn result in hampered insulin release and insulin resistance, with the observed obesity as a consequence.
Two bone turnover markers--serum bone-specific alkaline phosphatase (BALP) and osteocalcin (OC)--declined in the dried-plum group.
28] found increased serum osteocalcin in individuals on oral 20 mg of statin daily for four weeks.
After being exposed for 48 h to 100 [micro]g/ml PM extract, 1000 nM genistein, or 1000 nM puerarin, primary baboon osteoblasts markedly increased the rate of proliferation and mRNA levels of ALP and type I collagen without changes in Runx2, osterix, or osteocalcin expression.
Osteocalcin, Osteonectin, crosslaps, Serum estradiol (E2) and progesterone were measured using ADVIA Centaur automated competitive chemiluminescence immunoassay (Bayer HealthCare).
For example, the Gla-protein in bone, called osteocalcin, is responsible for making sure calcium is deposited in bones, while the Gla-protein in arterial walls, called matrix Gla protein, prevents calcium from being deposited in arteries.
Each sample (2 [micro]L cDNA) was tested with real-time SYBR Green PCR reagent (Life Technologies) with specific primers: 18S (forward: AGTCCCTG CCCTTTGTACACA; reverse: CGAT CCGAGGGCCTCACTA), GAPDH (forward: TGGCACAGTCAAGGCTGAGA; reverse: CTTCTGAGTGGCAGTGATGG), bone morphogenetic protein 2 (Bmp2) (forward: AAGC CAT C G AG G AACT TT CA GA; reverse: TCAC AGGA AATTTTGA GCTGGC), and osteocalcin (OCN): (forward: TCTGACAAAGCCTTCATGTCCA; reverse: AACGGTGGTGCCATAGAT).
Immunohistochemical staining for osteocalcin and osteonectin was performed on the confirmed osteosarcoma in the tibiotarsus and the spindle cell sarcoma mass.
Reverse transcription--polymerase chain reaction (RT-PCR) analysis was performed to identify the marker genes 28 days after differentiation; these were osteocalcin and osteopontin.
The most well known of these proteins are osteocalcin for bone building and Matrix-GLA for redirecting calcium from arteries.
Biochemical markers of bone formation by Osteocalcin and Bone-ALP and resorption by N-terminal collagen type 1 (NTX) and C-terminal collagen type 1(CTX) for bone turnover were assessed.