restriction site


Also found in: Thesaurus, Medical, Legal, Financial, Encyclopedia, Wikipedia.
ThesaurusAntonymsRelated WordsSynonymsLegend:
Noun1.restriction site - the specific sites at which a restriction enzyme will cleave DNA
site, situation - physical position in relation to the surroundings; "the sites are determined by highly specific sequences of nucleotides"
Translations
site de restriction
References in periodicals archive ?
Wild type AA genotype showed the presence of restriction site for Hinf I restriction enzyme and digested into two fragments of 177 bp and 73 bp.
The restriction site for NdeI enzyme was added before the start codon of confirmed gene sequence and complete open reading frame was ligated into pET22b (+) expression vector using NdeI and EcoRI restriction sites for both the gene and the vector.
Artificial transposable elements pTn5cat1 and pTn5Spcat endowed with restriction sites for PacI, PmeI and SwaI (unpublished) were used to obtain a collection of insertional mutants, each with an extra restriction site for these endonucleases.
Restriction fragment was identified after digestion with RsaI endonuclease; in particular two restriction sites (GT/AC) for allele A and only one restriction site for allele B were detected.
1) was produced using oligonucleotide primers p903SalI (5'GTCGACATAAG TAGGAAATTAAAGTCCAGTAAGGTTACTGGCATTTCT [This oligonucleotide primer was appended with a SalI restriction site (underlined) and the introduced late gene polyhedrin core promoter sequence, ATAAG (bold)]), and p738 (5'ACGAGCT GTGAACT CACCAAGAAT CCAACGTT) with cDNA being generated using oligonucleotide primer p738.
After analysis of PCR products by amplification of aflD gene, only the samples positive for Aspergillus fungi were used in the restriction site analysis.
The PCR product which contained the D2EDIII coding sequence preceded by DNA sequence coding for 6 histidine residues and flanked by the AatII restriction sites at both the 5' and 3' termini was then cloned into the corresponding AatII restriction site of pBS-HP-D2D (Fig.
Therefore, longer fragments affected by ADO could be misinterpreted as alleles without a mutation in the restriction site.
The variant T allele has a AvrII restriction site that results in two bands (208 bp and 172 bp) whereas the wild-type C allele lacks the AvrII restriction site, thus producing a single 380-bp band.
Oligonucleotides used to amplify CLCuKoV promoter were P1 (5' GTTGACTAAAATTGAATCACC-3') as forward with the addition of SacI restriction site and P2 (5'- CAAACGCATACTTAGCAACG-3') as reverse primer with the addition of SalI restriction site.