back mutation

(redirected from reverse mutation)
Also found in: Thesaurus, Medical, Legal, Encyclopedia.

back mutation

n.
A reversal process whereby a gene or other nucleotide sequence that has undergone mutation returns to its previous state.

back mutation

n
(Genetics) genetics the reversion of a mutant to the original phenotype
References in periodicals archive ?
sup][4] Primers used for sequencing analysis of the BIM gene were as follows: forward (F), CCTCATGATGAAGGCTAACTCAA; reverse wild-type (R-wt), TGGTGGTCACTTGTCAGAGGTT; and reverse mutation (R-mut), TGTTCTCCATA GAGGCTGTGCC.
The basic requirement is to assess genotoxicity initially in a bacterial reverse mutation test, followed by tests in mammalian cells in vitro and a mandatory test in a mammalian model in vivo.
Tests performed were acute oral toxicity, repeated dose 28-day oral toxicity, bacterial reverse mutation, in vitro chromosome aberration, micronucleus and dermal sensitization, as well as a 4-week immunotoxicity study.