zonula


Also found in: Thesaurus, Medical, Encyclopedia, Wikipedia.
Related to zonula: Zonula occludens, Zonula adherens

zonula

(ˈzəʊnjʊlə)
n
(Anatomy) a variant of zonule
ThesaurusAntonymsRelated WordsSynonymsLegend:
Noun1.zonula - small beltlike zone
zona, zone - (anatomy) any encircling or beltlike structure
Mentioned in ?
References in periodicals archive ?
3) Immunofluorescent staining of cultured cells at 48 hours show that TGF-[beta]1-treated, PTEN-deficient-mutant cells exhibited decreased expressions of zonula occludens-1 and claudin 4 compared with green fluorescent protein and PTEN wild types.
Vascular endothelial growth factor induces rapid phosphorylation of tight junction proteins occludin and zonula occluden 1.
TJ or zonula occludens (ZO) are the first and the least permeable membrane for paracellular transport of proteins formed by several transmembrane proteins, and they connect intercellularly to one another between cells in the extracellular space.
et al (2015) Structural Basis of a Key Factor Regulating the Affinity between the Zonula Occludens First PDZ Domain and Claudins.
1 Antisense:GGGACCTGCTCATAACTTCG GAPDH Sense:ATGGTGAAGGTCGGAGTGAAC NM_001206359 Antisense:CTCGCTCCTGGAAGATGGT Genes Product size (bp) EGF 106 EGFR 147 IGE-1 100 IGE-IR 132 MUC1 143 MUC2 116 Occludin 101 Claudin-1 141 ZO-1 133 GAPDH 235 EGF, epidermal growth factor; EGFR, epidermal growth factor receptor; IGF-1, insulin-like growth factor VJGF-IR, insulin-like growth factor 1 receptor; MUC1, mucin 1:MUC2, mucin 2; ZO-1, zonula occludens protein-1; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
capreolata (AFC) in the dinitrobenzenesulphonic acid (DNBS) model of experimental colitis in mice, correlating its potential anti-inflammatory activity to the expression of some of the mediators involved in the intestinal inflammatory response, such as pro-inflammatory cytokines, like IL-6, (IL)-1[beta], TNF-[alpha], IL-12 and IL-17, the chemokine intercellular adhesion molecule (ICAM)-l, the enzymes inducible nitric oxide synthase (iNOS) and the metalloproteinase (MMP)-9, as well as two markers of epithelial integrity in the mucosa, the mucin MUC-2 and the transmembrane protein zonula occludens (ZO)-1.
Irsogladine maleate counters the interleukinI b- induced suppression in gap-junctional intercellular communication but does not affect the interleukin-lb-induced zonula occludens protein- I levels in human gingival epithelial cells.
2+]-ATPase SCA: Sudden cardiac arrest SCD: Sudden cardiac death TGF-[beta]: Transforming Growth Factor-[beta] VT: Ventricular tachycardia VF: Ventricular fibrillation ZO-1: Zonula Occludens-1.
In the same way, sleep restriction decreased the mRNA levels of the tight junction proteins claudin-5, zonula occludens-2 (ZO-2), and occludin [8].
Sears, "Bacteroides fragilis enterotoxin cleaves the zonula adherens protein, E-cadherin," Proceedings of the National Academy of Sciences of the United States of America, vol.
TGF-[beta] disminuye la expresion de las proteinas del diafragma de hendidura como P-cadherina, zonula occludens-1 y nefrina, lo que contribuye a la desdiferenciacion y transicion epitelial-mesenquimal (EMT), tambien induce a la cinasa vinculada a integrina (ILK) que es importante en la EMT e incluso en la formacion de medias lunas celulares.
The addition of TNF-[alpha], IL-6, and IL-1[beta] to the cell culture and examination after 12 h showed marked down-regulation of tight-junction protein zonula occludens-1 (ZO-1) and slight decrease in occludin levels, and the loss of these proteins was abrogated by treatment with 50 [micro]M aprotinin (Fig.