ribosomal RNA

(redirected from 16S rDNA)
Also found in: Medical.

ribosomal RNA

n. Abbr. rRNA
The RNA that is a permanent structural part of a ribosome.

ribosomal RNA

n
(Biochemistry) biochem a type of RNA thought to be transcribed from DNA in the nucleoli of cell nuclei, subsequently forming the component of ribosomes on which the translation of messenger RNA into protein chains is accomplished. Sometimes shortened to: rRNA

ribosomal RNA


n.
a type of RNA, distinguished by its length and abundance, that functions in protein synthesis as a component of ribosomes. Abbr.: rRNA
[1960–65]
References in periodicals archive ?
Gram-positive, catalase-negative bacilli generating about 200 bp amplicon by PCR with Lactobacillus genus specific primers were further characterized by employing species specific primers followed by sequencing of 16S rDNA.
Amplification of 16S rDNA gene-V3 region, was performed by using the following primers: 16s rDNA V3, Forward, 5'-CCTACGGGAGGCAGCAG-3' and 16s rDNA V3, Reverse, 5'-ATTACCGCGGCTGCTGG-3'.
PCR primers F-968-GC (5'-CGCCCGGGG CGCGCCCCGGGCGGGGCGGGGGCACGGG GGGAACGCGAAGAACCTTAC-3') and R-1401 (5'-CGGTGTGTACAAGACCC-3') were combined to amplify the sequence of eubacterial 16S rDNA from nucleotide 968 to nucleotide 1401.
Moorpark, CA) has patented ammonia-oxidizing bacteria as well as isolated nucleotide sequences representative of 16S rDNA of these ammonia-oxidizing bacteria.
Conservation within the 16S rDNA is such that some sequences are shared by all bacteria, some by species of the same genus, and some regions are species specific.
Overall, 60 of the 78 cases of empyema (77%) were microbiologically confirmed either by culture or by 16S rDNA PCR, and 40 (51%) were found to have pneumococcal origins.
All resulting 16S rDNA sequences have been submitted to GenBank, as detailed in Table 1.
A naturally occurring bacterial strain with > 99% 16S rDNA sequence similarity to strain PM1 was detected in groundwater collected at various locations at Port Hueneme, including outside the plots where the organism was inoculated.
Suspected novel species will be confirmed by 16S rDNA sequencing.
Bacteria were also grown on nitrogen-free marine media and identified by sequencing the small subunit 16s rDNA.
The copy number of P aches 16S rDNA present in the surgical specimen of the current case was approximately 37-fold the levels in control specimen.