blastomycosis

(redirected from Blasto)
Also found in: Thesaurus, Medical, Encyclopedia.
Related to Blasto: blastomycosis

blas·to·my·co·sis

 (blăs′tō-mī-kō′sĭs)
n.
An infection caused by the fungus Blastomyces dermatitidis and characterized by multiple inflammatory lesions of the skin, mucous membranes, or internal organs.
American Heritage® Dictionary of the English Language, Fifth Edition. Copyright © 2016 by Houghton Mifflin Harcourt Publishing Company. Published by Houghton Mifflin Harcourt Publishing Company. All rights reserved.

blastomycosis

(ˌblæstəʊmaɪˈkəʊsɪs)
n
(Pathology) a fungal infection particularly affecting the lungs
Collins English Dictionary – Complete and Unabridged, 12th Edition 2014 © HarperCollins Publishers 1991, 1994, 1998, 2000, 2003, 2006, 2007, 2009, 2011, 2014

blas•to•my•co•sis

(ˌblæs toʊ maɪˈkoʊ sɪs)

n.
any of several diseases caused by certain yeastlike fungi, esp. blastomycetes.
[1895–1900]
blas`to•my•cot′ic (-ˈkɒt ɪk) adj.
Random House Kernerman Webster's College Dictionary, © 2010 K Dictionaries Ltd. Copyright 2005, 1997, 1991 by Random House, Inc. All rights reserved.
ThesaurusAntonymsRelated WordsSynonymsLegend:
Noun1.blastomycosis - any of several infections of the skin or mucous membrane caused by Blastomycesblastomycosis - any of several infections of the skin or mucous membrane caused by Blastomyces
chromoblastomycosis - a fungal infection characterized by itchy warty nodules on the skin
fungal infection, mycosis - an inflammatory condition caused by a fungus
Based on WordNet 3.0, Farlex clipart collection. © 2003-2012 Princeton University, Farlex Inc.
Translations

blas·to·my·co·sis

n. blastomicosis, infección causada por hongos que se inicia gen. en los pulmones.
English-Spanish Medical Dictionary © Farlex 2012

blastomycosis

n blastomicosis f
English-Spanish/Spanish-English Medical Dictionary Copyright © 2006 by The McGraw-Hill Companies, Inc. All rights reserved.
References in periodicals archive ?
The volunteers from Scottish Water left Fort William on Sunday morning on the first leg of their fundraising cycle, dubbed Blasto to Glasto, covering more than 500 miles to the Glastonbury festival at Worthy Farm in Somerset.
Primers used for PCR amplification Primer name Blasto FWD F5 GGTCCGGTGAACACTTTGGATTT 1641-1663 in AY244621 Blasto R F2 CCTACGGAAACCTTGTTACGACTTCA 1734-1759 in AY244621 Blastocystis TCGTGTAAATCTTACCATTTAGAGGA-BHQ1 1705-1730 in AY244321b probe FAM Table 2.
Thus, the ongoing pregnancy rate for morphologically good, euploid blasto cysts was 76% for those with normal/ low mtDNA levels, compared with 0% for those with elevated mtDNA levels--a highly statistically significant difference.
Secular Society then does duty for Baker in the finale, the Preis der Blasto AG conditions stakes over 1m2f.
What a privilege to be able to enjoy Sarah Blasto in an intimate setting in Middlesbrough.
Major Causes of Sclerosing (Fibrosing) Mediastinitis Infectious Histoplasmosis Other fungal infections (aspergillosis, cryptococcosis, blasto mycosis, mucormycosis) Tuberculosis Noninfectious Autoimmune conditions (eg, IgG4-related immuno- pathologic process) Sarcoidosis Radiation Drugs (eg, methysergide) Familial Idiopathic Table 3.
An oarctic blasto of northerly wind means it could be as deep as five inches in some parts.
Next in line was the Atoms, underage new wave blasto tunes, with a few killer covers like "Where's Captain Kirk," originally by Spizz Energi (which is, I guess, a decent comparison, although not much else Spizz Energi did was worthwhile).
Saskatchewan, Manitoba, Northern Ontario, Quebec and areas around the Great Lakes and Mississippi River are home to this fungal infection often referred to as 'blasto.' Inhalation of fungal spores that have been disturbed by construction, digging, and gardening, or by entry of the fungus through the skin, particularly if the soil contains a lot of rotting leaves or wood, can put you at risk for blastomycosis.
[Gk blasto germ, kystis bag]", Butterworths Medical Dictionary, supra note 14 at 235.