(redirected from CHN2)
Also found in: Medical.


abbreviation for
(Education) Bachelor of Surgery
[from Latin Baccalaureus Chirurgiae]
Collins English Dictionary – Complete and Unabridged, 12th Edition 2014 © HarperCollins Publishers 1991, 1994, 1998, 2000, 2003, 2006, 2007, 2009, 2011, 2014
References in periodicals archive ?
This mechanism is regulated by multiple genes, and genomic association analysis shows that the CHN2 gene is involved in the formation of addiction by partcipating in the remodeling of actin cytoskeletion.
Based on the important role of CHN2 in the changes of neuronal compensatory adaptation and substance addiction, we hypothesized that there was a difference in the methylation level of CHN2 gene between MA addicts and normal individuals.
The CHN2 gene sequence was referenced to GenBank (http://www.ncbi.nlm.nih.gov), which is as follows: GGAAACAGAGAAGCCTGGGGCTGGTGAGGGCCAGGACA GAAGGCCGGCGTGGGCAGATGGCGAAGGCTGCGAAGGG TAATGAGCGCTTCCTGAGGACTCTCAGAAGGCGGGGGTG GCTGGGT.Methylated primers and probes were designed by Beacon Designer (Version 7.0).
The OD value (260 nm) of CHN2 was 0.05 with a concentration of 210 ng/uL, and the Copies value was 2.1E + 12 Copies/uL.
Second case SSN7 (SRN) wants to get the scanner service but it is not available in the request node cluster (right side), then it forwards the service request to the gateway node (GWN) according to nearest and select the less number of hops from CHN (CHN2, SSN10, SSN11, CHN1).
6, where CHN1 receives the service request from CHN2 that resides with its [r.sub.0].
Where, [[rho].sup.ch1], [[rho].sup.ch2] is the position of the CHN1 and CHN2 respectively, the receiver CHN2 of the CHN1 at [[rho].sup.ch1] represents the CHN2 (CHN1, [[rho].sup.ch1]).