References in periodicals archive ?
Effect of arbuscular mycorrhizal inoculation on salt-induced nodule senescence in Cajanus cajan (pigeonpea).
Antihyperglycemic activity and brine shrimp lethality studies on methanol extract of Cajanus cajan (L.
MEAN NUMBER OF DAYS ([+ or -] SE) FOR EACH DEVELOPMENTAL STAGE OF RASTROCOCCUS ICERYOIDES REARED ON SIX HOST PLANT SPECIES (CUCURBITA MOSCHATA, MANGIFERA INDICA, PARKINSONIA ACULEATA, CAJANUS CAJAN, FICUS BENJAMINA, AND COFFEA ARABICA).
3) Holo Uze comprises boiled maize kernels (holo) mixed with Pigeon peas (uze) Cajanus cajan.
The tumor necrosis factor alpha (TNF-[alpha]) and interleukin 1 beta (IL-1[beta]) inhibitory activities of Cajanus cajan (leaves) crude methanolic extract, its fractions and its phytochemical constituents were evaluated in lipopolysaccharide (LPS) stimulated RAW 264.
PCR primers were designed based on the complete sequence of the defensin gene from six legumes available in the GenBank database (Cicer arietinum [DQ288897], Trigonella foenum-graecum [AY182163], Medicago sativa [AF319468], Arachis diogoi [AY288448], Cajanus cajan [AY244556], Tephrosia villosa [AY907349]), CtDefF(GGATCCATGGCAAT AAAATTT AGCCCA) and CtDefR (GAATTCTCAACAATCAAAGTAACAGAAGCA).
Plant species that showed the concentration values of phosphorus greater than 500mg/100g were leaves of Cleome gynandra, Acalypha bipartitae, Hyptis spicigera, Amaranthus graecizans, Solanum nigrum, Asystasia gangetica, seeds of Cajanus cajan, Corchorus olitorius and fruits of Cucumis figarei and Ficus sur (Table 4).