
(redirected from Choppa)
Also found in: Thesaurus, Encyclopedia, Wikipedia.


1. One that chops: a vegetable chopper.
2. Archaeology A crudely flaked core tool, especially one of the early Paleolithic Period.
3. A device that interrupts an electric current or a beam of radiation.
4. Informal A helicopter.
5. choppers Slang Teeth, especially a set of false teeth.
6. Informal A motorcycle, especially one that is customized.
7. Baseball A ground ball that is hit with a chopping swing, especially one that bounces high off the infield.
intr. & tr.v. chop·pered, chop·per·ing, chop·pers
Informal To travel by helicopter or transport (someone or something) by helicopter.
American Heritage® Dictionary of the English Language, Fifth Edition. Copyright © 2016 by Houghton Mifflin Harcourt Publishing Company. Published by Houghton Mifflin Harcourt Publishing Company. All rights reserved.


1. (Tools) chiefly Brit a small hand axe
2. (Tools) a butcher's cleaver
3. a person or thing that cuts or chops
4. (Aeronautics) an informal name for a helicopter
5. chiefly Brit a slang name for penis
6. (Electrical Engineering) a device for periodically interrupting an electric current or beam of radiation to produce a pulsed current or beam. See also vibrator2
7. (Automotive Engineering) a type of bicycle or motorcycle with very high handlebars and an elongated saddle
8. (Automotive Engineering) NZ a child's bicycle
9. (Firearms, Gunnery, Ordnance & Artillery) obsolete slang chiefly US a sub-machine-gun
Collins English Dictionary – Complete and Unabridged, 12th Edition 2014 © HarperCollins Publishers 1991, 1994, 1998, 2000, 2003, 2006, 2007, 2009, 2011, 2014


(ˈtʃɒp ər)

1. a person or thing that chops.
2. a short ax with a large blade, used for cutting up meat; butcher's cleaver.
3. choppers, Slang. the teeth.
4. a helicopter.
5. a motorcycle.
6. to travel by helicopter or motorcycle.
Random House Kernerman Webster's College Dictionary, © 2010 K Dictionaries Ltd. Copyright 2005, 1997, 1991 by Random House, Inc. All rights reserved.
ThesaurusAntonymsRelated WordsSynonymsLegend:
Noun1.chopper - a grounder that bounces high in the air
ground ball, groundball, grounder, hopper - (baseball) a hit that travels along the ground
2.chopper - informal terms for a human `tooth'chopper - informal terms for a human `tooth'  
tooth - hard bonelike structures in the jaws of vertebrates; used for biting and chewing or for attack and defense
3.chopper - an aircraft without wings that obtains its lift from the rotation of overhead bladeschopper - an aircraft without wings that obtains its lift from the rotation of overhead blades
vane, blade - flat surface that rotates and pushes against air or water
cargo helicopter - a helicopter that carries cargo
heavier-than-air craft - a non-buoyant aircraft that requires a source of power to hold it aloft and to propel it
landing skid - one of two parts of the landing gear of a helicopter
rotor - rotating mechanism consisting of an assembly of rotating airfoils; "there are horizontal rotors on a helicopter or compressor rotors in a jet engine"
shuttle helicopter - a helicopter that shuttles back and forth
single-rotor helicopter - a helicopter having a single rotor
skyhook - helicopter carrying a reel of steel cable that can be used to lift and transport heavy objects
4.chopper - a butcher's knife having a large square bladechopper - a butcher's knife having a large square blade
knife - edge tool used as a cutting instrument; has a pointed blade with a sharp edge and a handle
Based on WordNet 3.0, Farlex clipart collection. © 2003-2012 Princeton University, Farlex Inc.
طائِرَه مَرْوَحِيَّهمَفْرَمَه، ساطور
òyrlasaxari, kjötöxi


[ˈtʃɒpəʳ] N
1. (= axe) → hacha f; [of butcher] → tajadera f, cuchilla f
2. (= helicopter) → helicóptero m (Brit) (= bicycle) bicicleta de manillar alto y asiento alargado (US) (= motorbike) motocicleta de manillar alto y asiento alargado
Collins Spanish Dictionary - Complete and Unabridged 8th Edition 2005 © William Collins Sons & Co. Ltd. 1971, 1988 © HarperCollins Publishers 1992, 1993, 1996, 1997, 2000, 2003, 2005


[ˈtʃɒpər] n (= helicopter) → hélico m chopping block [ˈtʃɒpɪŋblɒk] nbillot mchopping board [ˈtʃɒpɪŋbɔːrd] nplanche f à découper
Collins English/French Electronic Resource. © HarperCollins Publishers 2005


(= axe)Hackbeil nt
(inf: = helicopter) → Hubschrauber m
(= bicycle)BMX-Rad nt; (inf: = motorcycle) → Maschine f (inf)
Collins German Dictionary – Complete and Unabridged 7th Edition 2005. © William Collins Sons & Co. Ltd. 1980 © HarperCollins Publishers 1991, 1997, 1999, 2004, 2005, 2007


[ˈtʃɒpəʳ] n (of butcher) → mannaia (Aer) (fam) → elicottero
Collins Italian Dictionary 1st Edition © HarperCollins Publishers 1995


(tʃop) past tense past participle chopped verb
(sometimes with up) to cut (into small pieces). He chopped up the vegetables.
a slice of mutton, pork etc containing a rib.
ˈchopper noun
1. an instrument for chopping.
2. a helicopter.
ˈchoppy adjective
(of the sea) rough.
ˈchoppiness noun
chop and change
to keep changing (especially one's mind).
chop down
to cause (especially a tree) to fall by cutting it with an axe. He chopped down the fir tree.
Kernerman English Multilingual Dictionary © 2006-2013 K Dictionaries Ltd.
References in periodicals archive ?
In 2010, he released his famous sucessful somg "Choppa Choppa Down" which brought his fame.
Johnson hopped up and celebrated by doing with the "Choppa Style" dance popularized by New Orleans rapper Choppa, whose namesake song had become a Saints' rallying cry and was even performed during the halftime show.
GET TO DA CHOPPA TO celebrate its 30th anniversary, Predator will be back on the big screen - for one night only.
The 7507 Choppa has a fixed blade length of 9.87" and measures 15" overall--a monster of a chopper!
With ( new catchphrases like "You are terminated" and "Get to the choppa," viewers will only have to wait a week to find out who will be the next celebrity making an exit from the competition.
urealyticum F:GTATTTGCAATCTTTATATGTTTTCG 55 R:TTTGTTGTTGCGTTTTCT Organism Amplicon Reference size Mycoplasma spp 287 bp Choppa et al., 1998 M.
His slurry, amiable voice is a rap radio constant--that's his sleepy drawl on the hook of Rick Ross's "Stay Schemin'," on last year's Lords of the Underground-checking "Shot Caller," on the lilting, menacing Waka Flocka Flame collaboration "Choppa Choppa Down." "Pop That," Excuse My French's antic strip club anthem featuring Drake, Lil Wayne and Rick Ross, recently landed in the Top 4o.
RIP x Maz, Sarah, Neil, Choppa and Lee xx MOORE Pat A long time dear friend who will be missed.
Peacefully in hospital on 11th July, aged 85 years, Alan, dearly loved husband of Maureen, Inga (Choppa), also loving dad and uncle to all the family.
(16.) Vojdani A, Choppa PC, Tagle C, Andrin R, Samimi B, Lapp CW.
Mythic Entertainment, as studio of Electronic Arts Inc (Nasdaq:ERTS), an interactive entertainment software company, announced on Tuesday (17 March) that two new careers, the Dwarf Slayer and Orc Choppa, are now playable in EA's MMORPG, Warhammer Online: Age of Reckoning (WAR).