
(redirected from Clock gene)
Also found in: Thesaurus, Medical, Encyclopedia.

clock 1

1. An instrument other than a watch for measuring or indicating time, especially a mechanical or electronic device having a numbered dial and moving hands or a digital display.
2. A time clock.
3. A source of regularly occurring pulses used to measure the passage of time, as in a computer.
4. Any of various devices that indicate measurement, such as a speedometer or a taximeter.
5. A biological clock.
6. The downy flower head of a dandelion that has gone to seed.
v. clocked, clock·ing, clocks
1. To time, as with a stopwatch: clock a runner.
2. To register or record with a mechanical device: clocked the winds at 60 miles per hour.
3. Informal To strike or hit (someone) forcefully, especially in the face.
1. To record working hours with a time clock: clocks in at 8:00 and out at 4:00.
2. To be measured or registered, especially at a certain speed or rate. Often used with in: a fastball that clocks in at 95 miles per hour.
Phrasal Verb:
clock up Chiefly British Slang
To accumulate; rack up: clocked up a number of wins.
around/round the clock
Throughout the entire 24 hours of the day; continuously.
clean (someone's) clock Slang
To beat or defeat decisively: "Immense linemen declared their intentions to clean the clocks of opposing players" (Russell Baker).
kill/run down/run out the clock
Sports To preserve a lead by maintaining possession of the ball or puck until playing time expires.

[Middle English clokke, from Old North French cloque, bell, or from Middle Dutch clocke, bell, clock, both from Medieval Latin clocca, of imitative origin.]

clock′er n.

clock 2

An embroidered or woven decoration on the side of a stocking or sock.

[Perhaps from clock, bell (obsolete), from its original bell-shaped appearance.]
American Heritage® Dictionary of the English Language, Fifth Edition. Copyright © 2016 by Houghton Mifflin Harcourt Publishing Company. Published by Houghton Mifflin Harcourt Publishing Company. All rights reserved.


1. (Horology) a timepiece, usually free-standing, hanging, or built into a tower, having mechanically or electrically driven pointers that move constantly over a dial showing the numbers of the hours. Compare digital clock, watch7
2. any clocklike device for recording or measuring, such as a taximeter or pressure gauge
3. (Botany) the downy head of a dandelion that has gone to seed
4. (Electronics) an electrical circuit that generates pulses at a predetermined rate
5. (Computer Science) computing an electronic pulse generator that transmits streams of regular pulses to which various parts of the computer and its operations are synchronized
6. (Industrial Relations & HR Terms) short for time clock
7. around the clock round the clock all day and all night
8. (Automotive Engineering) the clock an informal word for speedometer, mileometer
9. Brit a slang word for face
10. under pressure, as to meet a deadline
11. (Horse Training, Riding & Manège) (in certain sports, such as show jumping) timed by a stop clock: the last round will be against the clock.
12. (Athletics (Track & Field)) (in certain sports, such as show jumping) timed by a stop clock: the last round will be against the clock.
13. put the clock back to regress
14. (tr) slang Brit and Austral and NZ to strike, esp on the face or head
15. (tr) slang Brit to see or notice
16. (tr) to record (time) as with a stopwatch, esp in the calculation of speed
17. (Electronics) electronics to feed a clock pulse to (a digital device) in order to cause it to switch to a new state
[C14: from Middle Dutch clocke clock, from Medieval Latin clocca bell, ultimately of Celtic origin]
ˈclocker n
ˈclockˌlike adj


(Knitting & Sewing) an ornamental design either woven in or embroidered on the side of a stocking
[C16: from Middle Dutch clocke, from Medieval Latin clocca bell]
Collins English Dictionary – Complete and Unabridged, 12th Edition 2014 © HarperCollins Publishers 1991, 1994, 1998, 2000, 2003, 2006, 2007, 2009, 2011, 2014



1. an instrument, normally larger than a watch, for measuring and recording time, usu. with hands or changing numbers to indicate the hour and minute.
3. a meter for measuring and recording speed, distance covered, etc.
5. to time, test, or determine by means of a clock or watch: The racehorse was clocked at two minutes flat.
6. Slang. to strike sharply or heavily: clocked him in the face.
7. clock in (or out), to begin (or end) the day's work, esp. by punching a time clock.
around the clock,
a. for the entire 24-hour day without pause.
b. without stopping for rest; tirelessly.
[1350–1400; Middle English clok(ke) < Middle Dutch clocke bell, clock; akin to Old English clucge, Old High German glocka, Old Irish clocc bell; compare cloak]
clock′er, n.



an embroidered or woven design on the side of a sock or stocking at the ankle or leg.
[1520–30; orig. uncertain]
Random House Kernerman Webster's College Dictionary, © 2010 K Dictionaries Ltd. Copyright 2005, 1997, 1991 by Random House, Inc. All rights reserved.


Past participle: clocked
Gerund: clocking

I clock
you clock
he/she/it clocks
we clock
you clock
they clock
I clocked
you clocked
he/she/it clocked
we clocked
you clocked
they clocked
Present Continuous
I am clocking
you are clocking
he/she/it is clocking
we are clocking
you are clocking
they are clocking
Present Perfect
I have clocked
you have clocked
he/she/it has clocked
we have clocked
you have clocked
they have clocked
Past Continuous
I was clocking
you were clocking
he/she/it was clocking
we were clocking
you were clocking
they were clocking
Past Perfect
I had clocked
you had clocked
he/she/it had clocked
we had clocked
you had clocked
they had clocked
I will clock
you will clock
he/she/it will clock
we will clock
you will clock
they will clock
Future Perfect
I will have clocked
you will have clocked
he/she/it will have clocked
we will have clocked
you will have clocked
they will have clocked
Future Continuous
I will be clocking
you will be clocking
he/she/it will be clocking
we will be clocking
you will be clocking
they will be clocking
Present Perfect Continuous
I have been clocking
you have been clocking
he/she/it has been clocking
we have been clocking
you have been clocking
they have been clocking
Future Perfect Continuous
I will have been clocking
you will have been clocking
he/she/it will have been clocking
we will have been clocking
you will have been clocking
they will have been clocking
Past Perfect Continuous
I had been clocking
you had been clocking
he/she/it had been clocking
we had been clocking
you had been clocking
they had been clocking
I would clock
you would clock
he/she/it would clock
we would clock
you would clock
they would clock
Past Conditional
I would have clocked
you would have clocked
he/she/it would have clocked
we would have clocked
you would have clocked
they would have clocked
Collins English Verb Tables © HarperCollins Publishers 2011
ThesaurusAntonymsRelated WordsSynonymsLegend:
Noun1.clock - a timepiece that shows the time of dayclock - a timepiece that shows the time of day
alarm clock, alarm - a clock that wakes a sleeper at some preset time
analog clock - a clock that displays the time of day by the position of hands on a dial
chronometer - an accurate clock (especially used in navigation)
clock dial, clock face - the face of a clock showing hours and minutes of the day
cuckoo clock - clock that announces the hours with a sound like the call of the cuckoo
digital clock - a clock that displays the time of day digitally
electric clock - a clock using a small electric motor
fusee, fusee drive - a spirally grooved spindle in a clock that counteracts the diminishing power of the uncoiling mainspring
movement - the driving and regulating parts of a mechanism (as of a watch or clock); "it was an expensive watch with a diamond movement"
pendulum clock - a clock regulated by a pendulum
system clock - a time-of-day clock in a computer system
time clock - clock used to record the hours that people work
horologe, timepiece, timekeeper - a measuring instrument or device for keeping time
turret clock - a clock with more than one dial to show the time in all directions from a tower
wall clock - a clock mounted on a wall
clepsydra, water clock, water glass - clock that measures time by the escape of water
Verb1.clock - measure the time or duration of an event or action or the person who performs an action in a certain period of time; "he clocked the runners"
measure, quantify - express as a number or measure or quantity; "Can you quantify your results?"
mistime - time incorrectly; "She mistimed the marathon runner"
Based on WordNet 3.0, Farlex clipart collection. © 2003-2012 Princeton University, Farlex Inc.


round the clock morning, noon and night, all day, continuously, non-stop, day and night, night and day, without a break, twenty-four seven (informal) We have been working round the clock.
Collins Thesaurus of the English Language – Complete and Unabridged 2nd Edition. 2002 © HarperCollins Publishers 1995, 2002


To record the speed or duration of:
The American Heritage® Roget's Thesaurus. Copyright © 2013, 2014 by Houghton Mifflin Harcourt Publishing Company. Published by Houghton Mifflin Harcourt Publishing Company. All rights reserved.
سَاعَة حائِطساعَة لِقِياس السُّرْعَه أو المَسافَهساعَه كَبيرَه، ساعَة حاءِطيَقيس الوَقْت
klukkamælirtaka tímannúr
kaip sviestu pateptakiaurą parąlaikrodislaikrodžio mechanizmasmatuoti laiką
pulkstenisspidometrsatzīmēt laikuhronometrētmodinātājpulkstenis
saatsaat tutmakkilometre saati
đồng hồ


A. N
1. (= timepiece) (gen) → reloj m; [of taxi] → taxímetro m; (= speedometer) → velocímetro m; (= milometer) → cuentakilómetros m inv
you can't put the clock back (= return to past) → no puedes volver al pasado; (= stop progress) → no se puede detener el progreso
to keep one's eyes on or watch the clockmirar mucho el reloj (ansiando abandonar el trabajo)
to work against the clocktrabajar contra reloj
alarm clockdespertador m
around the clock
see round the clock
grandfather clockreloj m de pie, reloj m de caja
30,000 miles on the clock (Aut) → 30.000 millas en el cuentakilómetros
it's only got 60 miles on the clockeste coche ha hecho solamente 60 millas
round the clocklas veinticuatro horas del día
the garage is open round the clockel garaje está abierto las veinticuatro horas del día
we have surveillance round the clocktenemos vigilancia de veinticuatro horas, tenemos vigilancia permanente
to sleep round the clockdormir un día entero
2. (= face) → jeta f
1. (= time, measure) [+ runner, time] → cronometrar
we clocked 80mphalcanzamos una velocidad de 80 millas por hora
2. (Brit) (= hit) he clocked him onele dio un bofetón
C. CPD clock radio Nradio-despertador m
clock repairer Nrelojero/a m/f
clock tower Ntorre f de reloj
clock watcher N persona que mira mucho el reloj ansiando abandonar el trabajo
clock in VI + ADV (= mark card) → fichar, picar; (= start work) → entrar a trabajar
clock off VI + ADV (= mark card) → fichar or picar la salida; (= leave work) → salir del trabajo
clock on VI + ADV = clock in
clock out VI + ADV = clock off
clock up VT + ADV (Aut) → hacer
he clocked up 250 miles (Aut) → hizo 250 millas
Collins Spanish Dictionary - Complete and Unabridged 8th Edition 2005 © William Collins Sons & Co. Ltd. 1971, 1988 © HarperCollins Publishers 1992, 1993, 1996, 1997, 2000, 2003, 2005


[ˈklɒk] n
(for telling the time, large)horloge f; (small)pendule f
the church clock → l'horloge de l'église
round the clock, around the clock adv [work] → vingt-quatre heures sur vingt-quatre
to sleep round the clock, to sleep the clock round → faire le tour du cadran
to work against the clock → faire la course contre la montre
to beat the clock → finir en avance
to turn the clock back, to put the clock back → revenir en arrière
to watch the clock → surveiller l'heure alarm clock
(British) (= milometer) 30,000 miles on the clock → 30 000 milles au compteur
clock in
clock on vi (British)pointer (en arrivant)
clock off
clock out vi (British)pointer (en partant)
clock up
vt fus [+ miles, hours] → faireclock card ncarte f de pointageclock face ncadran mclock golf njeu m de l'horlogeclock-radio [ˌklɒkˈreɪdɪəʊ] nradio-réveil mclock tower clock-tower nclocher m
Collins English/French Electronic Resource. © HarperCollins Publishers 2005


Uhr f; round the clockrund um die Uhr; against the clock (Sport) → nach or auf Zeit; to work against the clockgegen die Uhr arbeiten; to beat the clockschneller als vorgesehen fertig sein; to put the clock back/forward or on (lit)die Uhr zurückstellen/vorstellen; to put or turn the clock back (fig)die Zeit zurückdrehen; to watch the clock (inf)dauernd auf die Uhr sehen
(inf: = speedometer, milometer) → Tacho m (inf); (of taxi)Uhr f; it’s got 100,000 miles on the clockes hat einen Tachostand von 100.000 Meilen
(Sport) he clocked four minutes for the mileer lief die Meile in vier Minuten; he’s clocked the fastest time this yearer ist die schnellste Zeit dieses Jahres gelaufen/gefahren
(inf: = hit) he clocked him oneer hat ihm eine runtergehauen (inf)
(Brit inf: = see) → sehen
(Brit inf) mileage to clock back (in betrügerischer Absicht) → den Meilenzähler zurückdrehen


in cpdsUhr(en)-;
clock card
nStechkarte f
clock face
nZifferblatt nt
clock golf
nUhrengolf nt
clock hour
nUhrmacher(in) m(f)
clock radio
nRadiouhr f
clock rate
n (Comput) (of CPU)Taktfrequenz f
clock speed
n (Comput) = clock rate
clock tower
nUhrenturm m
n she’s a terrible clocksie sieht or guckt dauernd auf die Uhr
nAuf-die-Uhr-Schauen nt
adj advim Uhrzeigersinn; in a clock directionim Uhrzeigersinn
n (of clock)Uhrwerk nt; (of toy)Aufziehmechanismus m; driven by clockzum Aufziehen; like clockwie am Schnürchen
train, caraufziehbar, zum Aufziehen
clock precisionäußerste Genauigkeit; with clock regularitymit der Regelmäßigkeit eines Uhrwerks; he arrives every day at 9.30 with clock regularityer kommt jeden Tag pünktlich auf die Minute um 9.30 Uhr
Collins German Dictionary – Complete and Unabridged 7th Edition 2005. © William Collins Sons & Co. Ltd. 1980 © HarperCollins Publishers 1991, 1997, 1999, 2004, 2005, 2007


1. n (gen) → orologio; (of taxi) → tassametro
30,000 on the clock (Brit) (Aut) → 30.000 sul contachilometri
around the clock → ventiquattr'ore su ventiquattro
to sleep round the clock or the clock round → dormire un giorno intero
to work against the clock → lavorare in gara col tempo
2. vt (time) → registrare; (of runner) → cronometrare
clock in clock on vi + adv (Brit) → timbrare il cartellino (all'entrata)
clock off clock out vi + adv (Brit) → timbrare il cartellino (all'uscita)
clock up vt + adv (Aut) → registrare, fare; (miles, hours) → fare
Collins Italian Dictionary 1st Edition © HarperCollins Publishers 1995


(klok) noun
1. an instrument for measuring time, but not worn on the wrist like a watch. We have five clocks in our house; an alarm clock (= a clock with a ringing device for waking one up in the morning).
2. an instrument for measuring speed of a vehicle or distance travelled by a vehicle. My car has 120,000 miles on the clock.
to register (a time) on a stopwatch etc.
ˈclockwise adverb
in the direction of the movement of the hands of a clock. The children moved clockwise round the room, then anticlockwise.
ˈclockwork noun
machinery similar to that of a clock. a toy which works by clockwork.
clock in/out/on/off
to register or record time of arriving at or leaving work.
clock up
to reach a total of. I've clocked up eight thousand miles this year in my car.
like clockwork
very smoothly and without faults. Everything went like clockwork.
round the clock
the whole day and the whole night. to work round the clock.
Kernerman English Multilingual Dictionary © 2006-2013 K Dictionaries Ltd.


سَاعَة حائِط hodiny ur Uhr ρολόι reloj, reloj de pared kello horloge sat orologio 時計 시계 klok klokke zegar relógio часы klocka นาฬิกา saat đồng hồ 时钟
Multilingual Translator © HarperCollins Publishers 2009


n. reloj;
around the ___durante las veinticuatro horas, de día y de noche.
English-Spanish Medical Dictionary © Farlex 2012
Collins Multilingual Translator © HarperCollins Publishers 2009
References in periodicals archive ?
This discovery was supplemented by discovery of another clock gene called 'timeless' in 1994 by Michael Young.
The refined protein sequences for each clock gene were then subjected to phylogenetic analysis in MEGA7 (Kumar et al, 2016), using ML with 1000 bootstrap replications.
If cells from the SCN are removed and cultured can engender autonomous circadian vacillations of clock gene expression as well as neuronal firing [9].
Togari, "Comparison of [beta]-adrenergic and glucocorticoid signaling on clock gene and osteoblast-related gene expressions in human osteoblast," Chronobiology International, vol.
Froy, "Differential effect of fructose on fat metabolism and clock gene expression in hepatocytes vs.
CREB, in turn, drives the induction of the core clock gene Per1 [127, 128].
Hrushesky, "Down regulation of circadian clock gene period 2 accelerates breast cancer growth by altering its daily growth rhythm," Breast Cancer Research and Treatment, vol.
For the allele-specific amplification of CLOCK gene 3111T/C, the primers (including forward primers marked by FAM and HEX) were 5'GAAGGTGACCAAGTTCATGCTAAAACACTGTCAGAACTGGCTG3' and 5'GAAGGTCGGAGTCAACGGATTCCTAAAACACTGTCAGAACTGGCTA3'.
A decade later, Young discovered another "clock gene".
Conclusion: The effect of isoflurane on the circadian clock is time-dependent, and administered isoflurane anaesthesia at night had minimal effect on clock gene expression.
Researchers also observed the decline of clock genes expression in rotenone-induced PD rodents.[sup][19] Consistently, we observed that the clock gene expression was also downregulated in 6-OHDA group.
In the Tg mice liver, the circadian expression of E-box-driven genes, Per2 and Dbp, was depressed markedly [38], suggesting the hyperrepressive ability in C414A CRY1 to the E-box-driven clock gene and also to E-box-driven clock-controlled genes in vivo.