gene expression

(redirected from Constitutive gene)
Also found in: Thesaurus, Medical, Encyclopedia.
Related to Constitutive gene: Gene activation
ThesaurusAntonymsRelated WordsSynonymsLegend:
Noun1.gene expression - conversion of the information encoded in a gene first into messenger RNA and then to a protein
organic phenomenon - (biology) a natural phenomenon involving living plants and animals
Based on WordNet 3.0, Farlex clipart collection. © 2003-2012 Princeton University, Farlex Inc.
References in periodicals archive ?
cDNA status was assessed by quantitative PCR using the constitutive gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as control.
In the semiquantitative RT-PCR, specific oligonucleotides were used for the NCED gene (GenBank: HM145908.1) (F-5'ATGATCCACGATTTCGCCAT3' and R-3'TCCCAAGCATTCCAAAGATG5') and for the constitutive gene Ubiquitin (F-5'CAACGCTCCATCTTGTCCTT3' and R-3'TGATCGTCTTTCCCGTAAGC5').
RT-PCR was performed with 2 [micro]g of RNA for the target gene and the ribosomal constitutive gene for semi-quantitation.