denatured alcohol

(redirected from Denaturat)
Also found in: Thesaurus, Medical, Encyclopedia.

de·na·tured alcohol

 (dē-nā′chərd)
n.
Ethyl alcohol to which a poisonous substance, such as acetone or methanol, has been added to make it unfit for consumption.

denatured alcohol

n
(Chemistry) chem ethanol rendered unfit for human consumption by the addition of a noxious substance, as in methylated spirits
ThesaurusAntonymsRelated WordsSynonymsLegend:
Noun1.denatured alcohol - ethyl alcohol that is unfit for drinking but is still useful for other purposes
ethanol, ethyl alcohol, fermentation alcohol, grain alcohol - the intoxicating agent in fermented and distilled liquors; used pure or denatured as a solvent or in medicines and colognes and cleaning solutions and rocket fuel; proposed as a renewable clean-burning additive to gasoline
methylated spirit - ethyl alcohol denatured with methyl alcohol to prevent its use as an alcoholic beverage
References in periodicals archive ?
ovale F GCTGTAGCTAATACTTGCTTTA 827 (curtisi and R TTCACCTCTGACATCTGAATC 827 wallikeri) PCR Program Denaturat AnnealiElongation Genus or Temp, Time, Temp, Time, Temp, species [degrees]C min [degrees]C min [degrees]C Plasmodium 94 1 58 2 72 94 1 58 2 72 P.
ADBLUE or equivalent) - 30 000 kg; Task 2 - Denaturat - 1 200 kg; task 3 - Grease for maintenance and encapsulation (eg.