romper

(redirected from rOmpA)
Also found in: Thesaurus, Acronyms.

romp·er

 (rŏm′pər)
n.
1. One that romps.
2. also rompers Any of various one-piece garments, often having short gathered legs, for infants or children.
3. A jumpsuit that has shorts.
American Heritage® Dictionary of the English Language, Fifth Edition. Copyright © 2016 by Houghton Mifflin Harcourt Publishing Company. Published by Houghton Mifflin Harcourt Publishing Company. All rights reserved.

romper

(ˈrɒmpə)
n
a variant of romp5
Collins English Dictionary – Complete and Unabridged, 12th Edition 2014 © HarperCollins Publishers 1991, 1994, 1998, 2000, 2003, 2006, 2007, 2009, 2011, 2014

romp•er

(ˈrɒm pər)

n.
1. a person or thing that romps.
2. Usu., rompers. (used with a pl. v.)
a. a one-piece garment combining a shirt and short, bloomerlike pants, worn by young children.
b. a similar garment worn by women and girls for leisure activity.
[1835–40]
Random House Kernerman Webster's College Dictionary, © 2010 K Dictionaries Ltd. Copyright 2005, 1997, 1991 by Random House, Inc. All rights reserved.

romper

A ship which has moved more than 10 nautical miles ahead of its convoy, and is unable to rejoin it. See also straggler.
Dictionary of Military and Associated Terms. US Department of Defense 2005.
ThesaurusAntonymsRelated WordsSynonymsLegend:
Noun1.romper - a person who romps or frolics
individual, mortal, person, somebody, someone, soul - a human being; "there was too much for one person to do"
2.romper - a one-piece garment for children to wear at playromper - a one-piece garment for children to wear at play; the lower part is shaped like bloomers
garment - an article of clothing; "garments of the finest silk"
Based on WordNet 3.0, Farlex clipart collection. © 2003-2012 Princeton University, Farlex Inc.
References in periodicals archive ?
Rr.190 70P rompA ATGGCGAATATTTCTCCAAAA Genus Rr.190 602N rompA AGTGCAGCATTCGCTCCCCCT Genus BG1-21 rompB GGCAATTAATATCGCTGACGG Genus BG2-20 rompB GCATCTGCACTAGCACTTTC Genus Ehrlichia spp.
.?" In "Amor prohibido" a much clearer explanation is provided regarding the dilemma faced by the poet in his relationship with his loved one, whereas in "Y cuando rompa el alba" the poet shares with the reader his hope for a future of union and happiness: "Entonces y solo entonces; / cuando tu mano y mi mano/ se encuentren una a la otra, / comprenderas que no he vuelto .
We tested for molecular evidence of any SFGR species by nested PCR of rompA (rickettsial outer membrane protein A gene) (1).