SRY gene


Also found in: Medical, Encyclopedia, Wikipedia.
Related to SRY gene: Swyer syndrome, SOX9

SRY gene

 (ĕs′är-wī′)
n.
A gene for maleness found on the Y chromosome. It has a key role in development of the testes and determination of sex.

[s(ex-determining) r(egion) Y.]
References in periodicals archive ?
High conservation of SRY gene in buffalo compared to other bovids.
No microdeletions were found in AZF regions and SRY gene.
Differentiation of the testis is initiated by the SRY gene located in the short arm of the Y chromosome by Week 7 of gestation.
Identification of a new mutation in the SRY gene in a 46, XY woman with Swyer syndrome.
The SRY gene has been shown to be integral to the development of male reproductive organs.
Only after the sixth week the SRY gene on the Y chromosome begins to produce androgen, primarily testosterone that encourages the development of male characteristics if the embryo is male.
1992), which allows the evaluation of DNA template viability in the first electrophoretic run; and another (SRYout), designed to amplify the external fragment (300bp) of the SRY gene ENSMUSG00000069036; (forward: 5'CGCCCCATGAATGCATTTAT3'; reverse: 3'CCTGTCCCACTGCAGAAGGT3'), being accepted that this fragment does not appear at the first electrophoretic analysis, considering that a low concentration of allogeneic cells may be present in the samples of blood and lungs from recipients.
Fragment size analysis of free fetal DNA in maternal plasma using Y-STR loci and SRY gene amplification.
2010) analyzed mtDNA control region sequences of 71 samples and SRY gene sequences of 39 samples, together with the available sequences in GenBank which showed that Yunnan gayal originated from the hybridization between male Bos frontalis and female Bos taurus or Bos indicus, and that Yunnan cattle mostly originated from B.
qPCR analysis was performed using primers and probes for the SRY gene located on chromosome Y and the HBB, both as previously described (6).
In 90% of cases it is due to translocation of SRY gene either to X chromosome or some autosome;