cytolysin


Also found in: Thesaurus, Medical, Encyclopedia, Wikipedia.

cy·tol·y·sin

 (sī-tŏl′ĭ-sĭn)
n.
A substance, such as an antibody, capable of dissolving or destroying cells.

cytolysin

(saɪˈtɒlɪsɪn)
n
(Biochemistry) a substance that can partially or completely destroy animal cells
ThesaurusAntonymsRelated WordsSynonymsLegend:
Noun1.cytolysin - a substance that partly or completely destroys animal cells
lysin - any substance (such as an antibody) or agent that can cause lysis
Mentioned in ?
References in periodicals archive ?
faecalis causes cytolysin in combination with high-level gentamicin resistance is associated with a five-fold increase in risk of death in human bacteraemia patients.
EHEC enterohemolysin (ehxA) is a pore-forming cytolysin carried by a plasmid involved in EHEC virulence.
faecalis detection Target Virulence factor Primer Sequence(59-39) Product gene size (bp) asal Aggregation ACA11 GCACGCTATTACGAACTATGA 375 substance ACA12 TAAGAAAGAACATCACCACGA GelE Gelatinase Gel11 TATGACAATGCTTTTTGGGAT 213 Gel12 AGATGCACCCGAAATAATATA cylA Cytolysin CYT I ACTCGGGGATTGATAGGC 688 CYT IIb GCTGCTAAAGCTGCGCTT esp Enterococcal ESP 14F AGATTTCATCTTTGATTCTTGG 510 surface protein ESP 12R AATTGATTCTTTAGCATCTGG hyl Hyaluronidase HYL n1 ACAGAAGAGCTGCAGGAAATG 276 HYL n2 GACTGACGTCCAAGTTTCCAA VanA Vancomycin- vanA 1 GGGAAAACGACAATTGC 175-191 resistant A vanA2 GTACAATGCGGCCGTTA 907-891 VanB Vancomycin- Van B1 ATGGGAAGCCGATAGTC 173-189 resistant B vanB 2 GATTTCGTTCCTCGACC 807-791 Table 2.
The virulence of enterococci is known to be conferred by various factors including but not limited to cytolysin (CylLLLSM), Enterococcal surface protein (Esp), aggregation substance (AS), gelatinase (GelE), E.
All these potential mechanisms of activation, recognition, and elimination of target cells by NK cells, alone or in combination, induce the release of the content of their lytic granules (perforin, granzyme, and cytolysin).
Listeria monocytogenes can activate all three branches of the UPR and downstream apoptotic signaling via secretion of cytolysin listeriolysin O (LLO), likely by disturbing ER calcium homeostasis through its pore-forming activity [121, 122].
Variations in lethal toxin and cholesterol-dependent cytolysin production correspond to differences in cytotoxicity among strains of Clostridium sordellii.
Separation and characterization of four different aminoacid sequence variants of a sea anemone (Stichodactyla helianthus) protein cytolysin. Toxicon.
faecium isolates are characterized by a high frequency of genes encoding putative virulence factors, such as collagen adhesin (acm gene), enterococcal surface protein (esp gene), hyaluronidase (hyl gene), gelatinase (gelE gene), endocarditis antigen (efa gene), and cytolysin (cyl operon) [6].
The three dimensional structure of Perfringolysin (PDB ID 1PFO) was selected as a template because it is the thiol-activated cytolysin whose structure showed better homology with the target sequence (PLY).
Superbugs No of Antibiotic resistance genes carrying by Plasmids the plasmids Enterococcus 95 Tetracycline, Streptothricin, Vancomycin, Erythromycin, Cytolysin, Chloramphenicol, florfenicol, Tigecycline, Daptomycin, Kanamycin, Streptomycin and Teicoplanin.
Some of the most important virulence factors include the production of hydrolytic enzymes, namely, gelatinase, lipase, and DNase, haemolytic activity and the production of cytolysin, the presence of adhesins, and the ability to form biofilms [127].