eubacteria


Also found in: Thesaurus, Medical, Encyclopedia, Wikipedia.
Related to eubacteria: archaebacteria

eu·bac·te·ri·um

 (yo͞o′băk-tîr′ē-əm)
n. pl. eu·bac·te·ri·a (-tîr′ē-ə)

[New Latin eubactērium, back-formed sing. of Eubactēria, former name of the domain Bacteria : Latin eu-, true (the domain Bacteria being considered as comprising the true bacteria, as opposed to the archaea); see eu- + bactēria, pl. of bactērium, bactērium; see bacterium.]
American Heritage® Dictionary of the English Language, Fifth Edition. Copyright © 2016 by Houghton Mifflin Harcourt Publishing Company. Published by Houghton Mifflin Harcourt Publishing Company. All rights reserved.

eubacteria

(ˌjuːbækˈtɪərɪə)
pl n, sing -rium (-rɪəm)
(Microbiology) a large group of bacteria characterized by a rigid cell wall and, in motile types, flagella; the true bacteria
[C20: via New Latin from Greek, from eu- (in the sense: true) + bacterium]
Collins English Dictionary – Complete and Unabridged, 12th Edition 2014 © HarperCollins Publishers 1991, 1994, 1998, 2000, 2003, 2006, 2007, 2009, 2011, 2014
ThesaurusAntonymsRelated WordsSynonymsLegend:
Noun1.eubacteria - a large group of bacteria having rigid cell walls; motile types have flagella
moneran, moneron - organisms that typically reproduce by asexual budding or fission and whose nutritional mode is absorption or photosynthesis or chemosynthesis
bacteria, bacterium - (microbiology) single-celled or noncellular spherical or spiral or rod-shaped organisms lacking chlorophyll that reproduce by fission; important as pathogens and for biochemical properties; taxonomy is difficult; often considered to be plants
B, bacillus - aerobic rod-shaped spore-producing bacterium; often occurring in chainlike formations; found primarily in soil
cocci, coccus - any spherical or nearly spherical bacteria
coccobacillus - a bacterial cell intermediate in morphology between a coccus and a bacillus; a very short bacillus
spirilla, spirillum - any flagellated aerobic bacteria having a spirally twisted rodlike form
division Eubacteria - one-celled monerans having simple cells with rigid walls and (in motile types) flagella
clostridia, clostridium - spindle-shaped bacterial cell especially one swollen at the center by an endospore
botulinum, botulinus, Clostridium botulinum - anaerobic bacterium producing botulin the toxin that causes botulism
clostridium perfringens - anaerobic Gram-positive rod bacterium that produces epsilon toxin; can be used as a bioweapon
blue-green algae, cyanobacteria - predominantly photosynthetic prokaryotic organisms containing a blue pigment in addition to chlorophyll; occur singly or in colonies in diverse habitats; important as phytoplankton
phototrophic bacteria, phototropic bacteria - green and purple bacteria; energy for growth is derived from sunlight; carbon is derived from carbon dioxide or organic carbon
pseudomonad - bacteria usually producing greenish fluorescent water-soluble pigment; some pathogenic for plants and animals
xanthomonad - bacteria producing yellow non-water-soluble pigments; some pathogenic for plants
nitric bacteria, nitrobacteria - soil bacteria that convert nitrites to nitrates
nitrosobacteria, nitrous bacteria - soil bacteria that oxidize ammonia to nitrites
thiobacillus - small rod-shaped bacteria living in sewage or soil and oxidizing sulfur
spirillum - spirally twisted elongate rodlike bacteria usually living in stagnant water
vibrio, vibrion - curved rodlike motile bacterium
corynebacterium - any species of the genus Corynebacterium
listeria - any species of the genus Listeria
enteric bacteria, enterics, enterobacteria, entric - rod-shaped Gram-negative bacteria; most occur normally or pathogenically in intestines of humans and other animals
endospore-forming bacteria - a group of true bacteria
rickettsia - any of a group of very small rod-shaped bacteria that live in biting arthropods (as ticks and mites) and cause disease in vertebrate hosts; they cause typhus and other febrile diseases in human beings
chlamydia - coccoid rickettsia infesting birds and mammals; cause infections of eyes and lungs and genitourinary tract
mycoplasma - any of a group of small parasitic bacteria that lack cell walls and can survive without oxygen; can cause pneumonia and urinary tract infection
actinomycete - any bacteria (some of which are pathogenic for humans and animals) belonging to the order Actinomycetales
actinomyces - soil-inhabiting saprophytes and disease-producing plant and animal parasites
mycobacteria, mycobacterium - rod-shaped bacteria some saprophytic or causing diseases
gliding bacteria, myxobacter, myxobacteria, myxobacterium, slime bacteria - bacteria that form colonies in self-produced slime; inhabit moist soils or decaying plant matter or animal waste
lactobacillus - a Gram-positive rod-shaped bacterium that produces lactic acid (especially in milk)
strep, streptococci, streptococcus - spherical Gram-positive bacteria occurring in pairs or chains; cause e.g. scarlet fever and tonsillitis
spirochaete, spirochete - parasitic or free-living bacteria; many pathogenic to humans and other animals
flagellum - a lash-like appendage used for locomotion (e.g., in sperm cells and some bacteria and protozoa)
Based on WordNet 3.0, Farlex clipart collection. © 2003-2012 Princeton University, Farlex Inc.
Translations
eubactérie
References in periodicals archive ?
found in green lizards and Ixodes ricinus ticks, Slovakia, 2004-2011 Primer Organism name Sequences, 5' [right arrow] 3' Family EHR747 GCACTCATCGTTTACAGCGTG Anaplasmataceae EHR521 TGTAGGCGGTTCGGTAAGTTAAAG Most eubacteria fD1 CCGAATTCGTCGACAACAGAGTTTGATCCTGGCTCAG rP2 CCCGGGATCCAAGCTTACGGCTACCTTGTTACGACTT Primer Length of amplified Organism name fragment, bp Reference Family EHR747 247 (10) Anaplasmataceae EHR521 Most eubacteria fD1 1,500 (9) rP2 Table 2.
All the diluted samples were cultured on two plates of different culture media, inorganic salts starch agar (ISP4) media supplemented with cycloheximide (100pg/ml) and colistin (5pg/ ml) for Actinomycetes; and tryptone soya agar supplemented with cycloheximide (30pg/ml) and penicillin (100pg/ml) for Eubacteria.
[3] The mechanism of water transport across the epithelia is well known in vertebrates, invertebrates, plants, eubacteria, archaebacteria, and other microbes.
HPA is a strictly anaerobic eubacteria, and most HPA species are mutualists [15, 16].
Lupski, "Distribution of repetitive DNA sequences in eubacteria and application to fingerprinting of bacterial genomes," Nucleic Acids Research, vol.
Interestingly, we found that Mimivirus is located in between the Eukaryota and prokaryote (Archaea + Eubacteria) branches, that is, at the prokaryote-to-eukaryote transition zone.
Fragments of the 16S rRNA genes of each bacterial isolate were separately amplified using the eubacteria universal primers rD1 (5'-AGA GTT TGA TCC TGG CT C AG-3') and fD1 (5'-AAG GAG GTG ATC CAG CC-37) [16].
Phylogenetic analysis was done in MEGA 5 and tree generated by neighbor joining method considering the two main domains eubacteria and archaea for bootstrap analysis (Katoh and Standley 2013).
It is thought that eubacteria divided using division machineries that were composed of more than 10 proteins, including filamentous temperature-sensitive (fts) proteins FtsA, FtsB, FtsI, FtsK, FtsL, FtsN, FtsQ, FtsZ, ZipA, and ZapA (Fig.