greisen


Also found in: Thesaurus, Encyclopedia, Wikipedia.

grei·sen

 (grī′zən)
n.
A granitic rock composed chiefly of quartz and mica.

[German, from greissen, to split.]

greisen

(ˈɡraɪzən)
n
(Geological Science) a light-coloured metamorphic rock consisting mainly of quartz, white mica, and topaz formed by the pneumatolysis of granite
[C19: from German, from greissen to split]
ThesaurusAntonymsRelated WordsSynonymsLegend:
Noun1.greisen - a granitic rock composed of quartz and mica
rock, stone - material consisting of the aggregate of minerals like those making up the Earth's crust; "that mountain is solid rock"; "stone is abundant in New England and there are many quarries"
References in periodicals archive ?
(38.) Fjolner J, Greisen J, Jorgensen MR, Terkelsen CJ, Ilkjaer LB, Hansen TM, et al.
* Thomas, Head & Greisen announced the appointment of Shane A.
Auf seinem greisen Haupte schellt und klingt Ein Narrenhelm statt einem Konigsband.
Greisen et al., "European Consensus Guidelines on the management of respiratory distress syndrome - 2016 update," Neonatology, vol.
Jakob Greisen, vice-president and head of the US motoring department at Bonhams, said the top end was performing well.
16StDNA gene of the extracted DNA was amplified using the primers 16S f5' AGGAGGTGATCCAACCGCA3' y 16S r 5 AACTGGAGGAAGGTGGGGAT3' (Greisen et al, 1994).
Greisen, "Tissue oximetry: a comparison of mean values of regional tissue saturation, reproducibility and dynamic range of four NIRS-instruments on the human forearm," Biomedical Optics Express, vol.
Greisen et al., "European consensus guidelines on the management of neonatal respiratory distress syndrome in preterm infants--2013 update," Neonatology, vol.
A specialized topaz-bearing rapakivi granite and associated mineralized greisen in the Ahvenisto Complex, SE Finland.