gyrase


Also found in: Medical, Wikipedia.

gyrase

(ˈdʒaɪˌreɪz)
n
(Biology) biology a topoisomerase enzyme
References in periodicals archive ?
This resistance to quinolones was caused by amino acid substitutions in the quinolone resistance-determining region (QRDR) of the DNA gyrase subunit gyrA, a key target of quinolones.
Additional identification was determined by sequencing of the pyrazinamidase A gene, which demonstrated a C at nt 169 that results in the functional wild-type pyrazinamidase A gene, and of the gyrase B gene that showed the G at nt 1311 and a C at position 1410 (online Technical Appendix).
Bacteria cultured from trunk wash and tissue samples were further identified by PCR reactions by using 16S rRNA, 16S-23S-rDNA internal transcribed spacers (ITS) (7,8), and gyrase B (gyrB) primers (Table 1).
alsatica amplification and specific identification was confirmed by using 2 new specific PCRs with primers and TaqMan probes (Applied Biosystems, Courtaboeuf, France) specific for a portion of the heat shock protein 60 (hsp60) and the DNA gyrase subunit B (gyrB) genes of B.
PCR amplification of the genes encoding DNA gyrase (gyrA and gyrB) and topoisomerase IV (parC and parE) and subsequent sequencing of PCR products were performed (2).
The gyrB gene (encoding for gyrase B) sequence, used to identify M.
difficile has been associated with mutations in the active site of DNA gyrase (10-12).
Primers used in study of hospitalized patients with Clostridium difficile infection, Canada, 2004-2008 Sequence (5' Primer [right arrow] 3') Specificity tcd3 TGCAATTATAAAAACATCTTTAAAC tcdC PaLoc negative regulator tcd4 TATATCTAATAAAAGGGAGATTG cdtS-F1 TGGACAGGAAGAATAATTCCTTC cdtB binary toxin subunit B cdtS-R1 TGCAACTAACGGATCTCTTGC E5 CTCAAAACTTTTTAACGAGTG ermB erythromycin/clindamycin resistance E6 CCTCCCGTTAAATAATAGATA GyrAF TTGAAATAGCGGAAGAAATGA gyrA DNA gyrase subunit A GyrAR TTGCAGCTGTAGGGAAATC GyrBF GAAGGTCAAACTAAAACAAA gyrB DNA gyrase subunit B GyrBR GGGCTCCATCTACATCG Table 2.
# Inhibits bacterial DNA replication enzymes, DNA gyrase A, and topoisomerase IV.
While fluoroquinolones are designed to inhibit the bacterial topoisomerase gyrase, which leads to the death of the bacterium, they also inhibit the topoisomerase 2 of our own cells.