housekeeping gene


Also found in: Thesaurus, Medical, Acronyms, Encyclopedia, Wikipedia.

housekeeping gene

n.
Any of a group of genes that are expressed in all cells and code for proteins that are essential for basic cell growth and metabolism.
Translations
gène domestique
References in periodicals archive ?
Thus, when using a housekeeping gene as a reference, evaluation of its expression stability usually is required.
Figure 1 displays the normalized data of IGF-1, IGF-1R and IGF-BP3 mRNA levels as the ratio of the target to the housekeeping gene by assigning the control group a factor of 1.
1 CYP4B1 TGACCATGTGCATCAAAGGAG Other drug-metabolizing enzymes NM_000120 EPHX1 TGATGAGGGAGAGCGGGCTAC NM_002021 FMO1 GCTGTTCGAGTCCTGAAAGG NM_006894 FMO3 GGCAGGGCTAGCATTTACAA NM_001461 FMO5 CTCTCAGTTTCATATTGCCCAG NM_000846 GSTA2 GCCCAAGCTCCACTACTTCA NM_000561 GSTM1 TTCCCAATCTGCCCTACTTG XM_040116 GSTP1 ACCTCCGCTGCAAATACATC XM_003547 UGT2A1 TTGGCCAATGGAAGGTAGTC Nuclear transcription factors NM_001621 AHR CTGCCTTTCCCACAAGATGT NM_005122 NR1I3 GTCATGGCCAGTAGGGAAGA M10901 NR3C1 GCTCTGGGGTGGAGATCATA U22662 NR1H3 TCAACCCCATCTTCGAGTTC AF061056 NR1I2 TTGTTCGGCATCACAGGTAG Housekeeping gene NM_021130 Cyclophilin CTTGCCATTCCTGGACCCAA Product Accession no.
5% in leaves and 1 to 2% of the housekeeping gene expression level in flowers, with no significant differences among the genes (Fig.
There was very good amplification of housekeeping gene (GAPDH) in all the tumors.
Figures 3(a) and 3(b) present typical amplification and melting curves for SOD2 mRNA and the housekeeping gene beta-actin mRNA from a hemodialysis patient, a patient with CKD, and a control subject.
Expression level of ACT1 gene, which is a housekeeping gene, was determined in each set of experiment (data not shown).
We also quantified the transcripts of the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as an endogenous control to normalize each sample using sense and antisense primers, 5' CCA TCA CCA TCT TCC AGG AGC 3' (positions 278-298) and 5' GGA TGA TGT TCT GGA GAG CC 3' (positions 663-682), respectively (Tokunaga et al.
org/szooepidemicus/) based on the allelic profile of 7 housekeeping gene fragments.