intron

(redirected from intervening sequence)
Also found in: Thesaurus, Medical, Acronyms, Encyclopedia.
Related to intervening sequence: lariat

in·tron

 (ĭn′trŏn)
n.
A segment of a gene situated between exons that is removed before translation of messenger RNA and does not function in coding for protein synthesis.

[intr(agenic), occurring within a gene (intra- + genic) + -on.]

intron

(ˈɪntrɒn)
n
(Genetics) biochem a stretch of DNA that interrupts a gene and does not contribute to the specification of a protein. Compare exon2
[C20: from intr(agenic) (regi)on]

in•tron

(ˈɪn trɒn)

n.
a noncoding segment in DNA that interrupts a gene-coding sequence or nontranslated sequence. Compare exon.
[1975–80; perhaps intr (o)- + -on1]
ThesaurusAntonymsRelated WordsSynonymsLegend:
Noun1.intron - sequence of a eukaryotic gene's DNA that is not translated into a protein
deoxyribonucleic acid, desoxyribonucleic acid, DNA - (biochemistry) a long linear polymer found in the nucleus of a cell and formed from nucleotides and shaped like a double helix; associated with the transmission of genetic information; "DNA is the king of molecules"
coding DNA, exon - sequence of a gene's DNA that transcribes into protein structures; "exons are interspersed with introns"
Translations
intron
References in periodicals archive ?
Canine oral papillomavirus genomic sequence: a unique 1.5-kb intervening sequence between the E2 and L2 open reading frames.
Electropherogram showed that both mother and father were heterozygous (carrier) for intervening sequence I-5 mutation whereas the affected child was homozygous for this mutation.
Much of the intervening sequence is intronic and intergenic space littered with the remains of mobile DNAs.
To confirm the pathogen as Fusarium oxysporum species, 16S rDNA intervening sequence specific ITS FU F (5' CAACTCCCAAACCCCTGTGA 3') and ITS FU R (5' GCGACGATTACCAGTAACGA 3') primers were used to get an amplicon of 389 bp size (19).