ragment

ragment

(ˈræɡmənt)
n
a statute, roll, or list
Collins English Dictionary – Complete and Unabridged, 12th Edition 2014 © HarperCollins Publishers 1991, 1994, 1998, 2000, 2003, 2006, 2007, 2009, 2011, 2014
References in periodicals archive ?
The new police chief found the skull f ragment was likely to be a piece of coconut.
The third marker, ox4 Tox5 (5'CGCTGCAGGGAGGAAGACGAAAGTTG3' and 5'CGCTGCAGACACAGTGCATCTGGATT3'), amplified a non-coding 529 bp ragment that is repeated 200-300-fold in the genome of T.
In his Atthis Androtion treated such earlier matters as cult and religion F(ragment) 1-2 and various political and legal institutions (FF 3, 4, 6, 9, and so on).
For PCL tibial avulsions especially with small bony ragments that require a combination of sutures and bone fixation, an open posterior tibial approach is favored by many authors because it provides good exposure and allows for secure fixation.
The fS ragments of coffin and robe from St Cuthbert's shrine are mounted in a display box thought to date from the 19th Century.