restriction site


Also found in: Thesaurus, Medical, Financial, Encyclopedia, Wikipedia.
ThesaurusAntonymsRelated WordsSynonymsLegend:
Noun1.restriction site - the specific sites at which a restriction enzyme will cleave DNA
site, situation - physical position in relation to the surroundings; "the sites are determined by highly specific sequences of nucleotides"
Translations
site de restriction
References in periodicals archive ?
Besides, bands of same size may not come from the same part of the chromosome, change in one restriction site can result in more than one band change, and inability to differentiate isolates to the same degree that can be achieved by whole genome sequencing (WGS) are other key restraining factors.
Xmn1 restriction site was present at 158 bp upstream of the Gamma globin gene on chromosome 11 of positive patients (GenBank KY927385).
Wild type AA genotype showed the presence of restriction site for Hinf I restriction enzyme and digested into two fragments of 177 bp and 73 bp.
In order to clone the fragment containing the [beta]-globin gene promoter in a pBluescript II SK (pSK) vector, [beta]_KpnI and [beta]_XhoI primers, engineered to contain both KpnI and XhoI restriction site, respectively, were used.
1) was produced using oligonucleotide primers p903SalI (5'GTCGACATAAG TAGGAAATTAAAGTCCAGTAAGGTTACTGGCATTTCT [This oligonucleotide primer was appended with a SalI restriction site (underlined) and the introduced late gene polyhedrin core promoter sequence, ATAAG (bold)]), and p738 (5'ACGAGCT GTGAACT CACCAAGAAT CCAACGTT) with cDNA being generated using oligonucleotide primer p738.
After analysis of PCR products by amplification of aflD gene, only the samples positive for Aspergillus fungi were used in the restriction site analysis.
Therefore, longer fragments affected by ADO could be misinterpreted as alleles without a mutation in the restriction site. This problem can be avoided with ddRAD, for which two restriction enzymes are utilized (Davey et al., 2013).
The variant T allele has a AvrII restriction site that results in two bands (208 bp and 172 bp) whereas the wild-type C allele lacks the AvrII restriction site, thus producing a single 380-bp band.
Oligonucleotides used to amplify CLCuKoV promoter were P1 (5' GTTGACTAAAATTGAATCACC-3') as forward with the addition of SacI restriction site and P2 (5'- CAAACGCATACTTAGCAACG-3') as reverse primer with the addition of SalI restriction site.
The Kpnl_lexA.box_TEM forward primer was designed in order to contain the restriction site KpnI, the lexA regulon and the first twenty-two nucleotides of [bla.sub.tem-1] gene.