ribosome

(redirected from ribosomal)
Also found in: Thesaurus, Medical, Encyclopedia.

ri·bo·some

 (rī′bə-sōm′)
n.
A structure composed of RNA and protein, present in large numbers in the cytoplasm of living cells and serving as the site for assembly of polypeptides encoded by messenger RNA.


ri′bo·so′mal (-sō′məl) adj.

ribosome

(ˈraɪbəˌsəʊm)
n
(Biochemistry) any of numerous minute particles in the cytoplasm of cells, either free or attached to the endoplasmic reticulum, that contain RNA and protein and are the site of protein synthesis
[C20: from ribo(nucleic acid) + -some3]
ˌriboˈsomal adj

ri•bo•some

(ˈraɪ bəˌsoʊm)

n.
a tiny, mitten-shaped organelle occurring in great numbers in the cell cytoplasm and functioning as the site of protein manufacture.
[1958]
ri`bo•so′mal, adj.

ri·bo·some

(rī′bə-sōm′)
A sphere-shaped structure within the cytoplasm of a cell that is composed of RNA and protein and is the site of protein synthesis. Ribosomes are often attached to the membrane of the endoplasmic reticulum. See more at cell.
ThesaurusAntonymsRelated WordsSynonymsLegend:
Noun1.ribosome - an organelle in the cytoplasm of a living cell; they attach to mRNA and move down it one codon at a time and then stop until tRNA brings the required amino acid; when it reaches a stop codon it falls apart and releases the completed protein molecule for use by the cell; "the ribosome is the site of protein synthesis"
cell organ, cell organelle, organelle - a specialized part of a cell; analogous to an organ; "the first organelle to be identified was the nucleus"
Translations
ribosomi
netkorn
ribosom
References in periodicals archive ?
UtiMax ID/AST is an electrochemical-based sandwich hybridization test to quantify species-specific ribosomal 16S ribosomal RNA (rRNA).
Among them are assessing the contributions of motor enzymes and microtubule dynamics to mitotic chromosome motions, cell sheet morphogenesis: dorsal closure in Drosophila melanogaster as a model system, ribosomal stalling during translation: providing substrates for ribosome-associated protein quality control, mechanisms of tail-anchored membrane protein targeting and insertion, sex and gender differences in the outcomes of vaccination over the life course.
Sequence analysis of the amplified partial 18S short subunit ribosomal RNA coding region from examination of formalin-fixed tissue by using PCR disclosed a 93% identity to Eimeria reichenowi in GenBank, suggesting a novel Eimeria species.
Amplification and sequencing of the partial rDNA gene was accomplished with primers: one primer (F: 5'TTGATTACGTCCCTGCCCTTT3'), located in the 3' portion of 18S, the small ribosomal subunit gene, approximately 182bp from its junction with ITS1, the first internally transcribed spacer (110bp) and the second primer (R: 5'TTTCACTCGCCGTTACTAACG3'), is located in the 5' portion of 28S, the large ribosomal subunit gene approximately 80bp from the junction with ITS2, the second internally transcribed spacer (101bp).
The study, conducted in both human and mouse cells, shows that cancer genomes lose copies of repetitive sequences known as ribosomal DNA.
has developed a test to detect Helicobacter pylori and mutations at 2142G and 2143G on the 23S Ribosomal RNA.
Canadian biotechnology company Phoenix Molecular Designs (PhoenixMD) is claiming a "significant research breakthrough" in the development of a novel therapy for the treatment of triple negative breast cancer with new preclinical data for its lead asset, PMD-026, an oral small molecule that selectively targets RSK (p90 ribosomal S6 kinase) in TNBC and suppresses tumor growth, the company said.
In particular, we want to study two different exosome-ribosome assemblies that underpin opposite outcomes of RNA degradation: a constructive function of the nuclear exosome in the maturation of the large ribosomal subunit and a destructive function of the cytoplasmic exosome in the elimination of ribosome-bound mRNAs.
The ribosomal RNA genes (rDNA) possess characteristics that are suitable for the detection of pathogens at specific level.
The most employed molecular markers for phylogenetic purposes were related to ribosomal nuclear genes (Figure 3).
16S ribosomal DNA amplification for phylogenetic study.
Singh, who is a postdoctoral research associate at Texas Tech University Health Sciences Center in Amarillo, and her coinvestigators used 16S ribosomal RNA sequencing and quantitative analysis to evaluate the composition of gut microbiota in 40 patients who had CKD and diabetic neuropathy.