secretional

secretional

(sɪˈkriːʃənəl)
adj
of or relating to secretion
Collins English Dictionary – Complete and Unabridged, 12th Edition 2014 © HarperCollins Publishers 1991, 1994, 1998, 2000, 2003, 2006, 2007, 2009, 2011, 2014
References in periodicals archive ?
Gene Primer sequence (5' [right arrow] 3') Type II collagen GGCAATAGCAGGTTCACGTACA CGATAACAGTCTTGCCCCACTT Type X collagen CAAGGCACCATCTCCAGGAA AAAGGGTATTTGTGGCAGCATATT Aggrecan TACGAAGACGGCTTCCACCA CTCATCCTTGTCTCCATAGC SOX9 GTACCCGCACTTGCACAAC GTAATCCGGGTGGTCCTTCT CD44 AAGACACATTCCACCCCAGT GGTTGTGTTTGCTCCACCTT GAPDH ATGGGGAAGGTGAAGGTCG TAAAAGCAGCCCTGGTGACC TABLE 2: Secretional capacity of proteins per 10,000 hMSCs (pg/10,000 hMSCs).
Secretory granules are seen near apical part of cells, showing supranuclear secretional zone.
Flash-points deadening and twining With wall: Rain, and its nailed smoke-- Cobbled, snailing surfaces, Jammed drops at the dead-level stroke gravity's slow Secretional slashes on this house-- Lost laterals, rinses...
This current study would appear to suggest that enamel malformation in the diabetic animals may be due to decreased secretional and maturational function of the ameloblasts, rather than through a deficiency of calcium and phosphorus.
In clinical chemistry, iontophoresis has already been established as a tool used in the diagnosis of cystic fibrosis (in this setting, pilocarpine is administered to test the secretional function of the sweat glands) (4).