stop codon


Also found in: Medical, Encyclopedia, Wikipedia.

stop codon

n.
Any of three codons, UAA, UAG, or UGA, that signal the termination of the synthesis of a protein. Also called chain termination codon, termination codon.
American Heritage® Dictionary of the English Language, Fifth Edition. Copyright © 2016 by Houghton Mifflin Harcourt Publishing Company. Published by Houghton Mifflin Harcourt Publishing Company. All rights reserved.
References in periodicals archive ?
is a clinical-stage biopharmaceutical company developing novel RNA-modulating drug candidates (designed to be eukaryotic ribosomal selective glycosides) that are formulated to treat rare and ultra-rare premature stop codon diseases.
The Fha inactivation probably resulted from changes within the homopolymeric G tract (site: 1078-1087) from 10 Gs to 11 Gs in fhaB, resulting in a downstream stop codon that produces a truncated FhaB protein (11).
The deletion causes a frameshift mutation and a premature stop codon (p.Asn574LysfsTer19; NM_001135243) of the treacle protein.
Since the duplication c.910dupG introduced a premature stop codon early in the translation (at position 306), the dimerization domain with PMS2/MLH3/PMS1, as well as the interaction domain with hExoI, would be lost, leading to a non-functional protein (Figure 2a).
The forward primer with a Xbal cut site and a His-tag overhang (5'ATTATCT AGACACCACCACCACCACCATGATGATGATGA TAAGAGCGTGAG3") and reverse primer with a Aatll cut site and stop codon overhang (5'GCGCGACG TCTTAGAAGTTATGCACATCCTG3') were designed in accordance with the cloning strategy and were used to amplify TPD gene from pET32a-TPD vector.
By changing an A to an I within a codon, its "readout" (translation to amino acid) within the ribosome can be altered, leading to missense mutations (substitution of one amino acid for another), nonsense mutations (substitution of an amino acid for a STOP codon), or STOP suppressions (substitution of a STOP condon for a sense codon, leading to a product with some random C terminal tail).
As is seen in table 1, we found an undescribed homozygous mutation in exon 4 of the GAA gene (c.730C>T p.Q244*), creating a premature stop codon and leading to a truncated protein or loss of protein production.
This substitution is a nonsense variant predicted to lead to the alteration of a cysteine into a premature stop codon on position 1484 (LAMA2:p.Cys1484X).
Thenucleotidechangepredicted an amino acid substitution of tryptophan to a premature stop codon at residue 155 (W155X).
Direct sequencing of all 11 exons of PRKAR1A of this patient identified a 88 A to G mutation, which changes the initiator ATG to a GTG codon, abolishes the translational start codon but does not introduce a premature stop codon [Figure 1]e.
Interestingly, we found that the g.451A>G mutation was a synonymous mutation whereas g.462-463CC insertion caused a frameshift mutation which both changed the amino acids after 23rd codon and generated a premature stop codon at position 56 (Figure 2C, Figure 3).