References in periodicals archive ?
Real time PCR reaction solution contains cDNA template, 0.3 [micro]L forward primer (0.3 mM), 0.3 [micro]L reverse primer (0.3 [micro]M), 5 [micro]L 2 x SuperReal PreMix Plus and RNase-Free dd[H.sub.2]O to a final volume of 10 [micro]L.
A volume of 20 [micro]L of the reaction system contained 10 [micro]L of 2X SuperReal PreMix, 1 [micro]L of diluted reverse transcription product, 2 [micro]L of each specific primer (10 [micro]mol/L), 0.4 [micro]L of ROX (50x), and 6.6 [micro]L of dd[H.sub.2]O.
All qRT-PCR was conducted using SYBR Green SuperReal PreMix Plus (FP205; Tiangen) on an ABI 7900HT (Applied Biosystems, Foster City, CA, USA).
To assess the expression of target genes, quantitative real-time PCR was performed using SuperReal Color PreMix (FP216, Tiangen Biotech Co.
qPCR was performed using SuperReal PreMix (SYBR Green) (Tiangen, Beijing, China) with iQ SYBR Green SuperMix (Bio-Rad).
Then, Real-Time PCR was conducted using a SuperReal PreMix Plus (SYBR green) detecting kit as the manufacturer's protocol description.
The expression of the [beta]-amyloid gene amy-1 (forward, 5'-CCGACATGACTCAGGATATGAAGT-3', reverse, 5'-CACCATGAGTCCAATGATTGCA-3'); DAF-16 (forward, 5'- GAAAGAGCTCGTGGTGGGTTATTA3', reverse, 5'-TCCGCGGCGAGATTTTTC-3'); sod-3 (forward, 5'-AGCATCATGCCACCTACGTGA-3', reverse, 5'-CACCACCATTGAATTTCAGCG-3'); and small heat shock protein hsp-16.2 (forward, 5'-CTGCAGAATCTCTCCATCTGAGTC-3', reverse, 5' -AGATTCGAAGCAACTGCACC-3') were determined by qRT-PCR performed on a qTOWER 2.2 Real-Time PCR System (Analytik Jena AG, Thuringia, Germany) using SuperReal PreMix Plus (SYBR Green; Tiangen, Beijing, China).
Real-time qPCR was performed using SuperReal PerMix Plus (SYBR Green/probe) (TIANGEN) and primers specific for algU (Forward: 5'AACACCGCGAAGAACCACCT-3', Reverse: 5'-ATCTCATCCCGCAACATCGCG-3'), algA (Forward: 5'-AGAACTGAAGAAGCACGACG-3', Reverse: 5'-TTCTCCATCACCGCGTAGT-3'), pelA (Forward: 5'-ATGGCTGAAGGTATGGCTG-3', Reverse: 5'-AGGTGCTGGAGGACTTCATC-3'), and pslM (Forward: 5'-CTATGACGCACGGCAACTGG-3', reverse: 5'-CGCCATTGACCAGGTGCAT-3').
The amplification was performed using a SuperReal PreMix Plus Kit (Tiangen) and an ABI 7500 RT-PCR system (Applied Biosystems, Foster City, USA).
"Gato en el camino" es un relato absurdo, fantastico, surrealista, superreal, pero al mismo tiempo parodico, americanista, critico y antipolitico.
"Il Penseroso: The Fat Lady" features the poet back on the road, this time I-95, which is "rushing / up too superreal like a movie-promo / before digital got finesse." An italicized stanza reveals her writerly frustrations:
Desde lo fantastico hasta lo que ha sido llamado onirico y superreal o surreal en su obra, Reyes anticipa una libertad de generos y registros que lo vincula, mas alla de lo estilistico, ademas de Borges, a Sergio Pitol, Juan Jose Arreola y Roberto Bolano.